Description :
From Genome Similarity Track
Location :
Scaffold_453:2587- 4197
Transcript NameFunction/comments
Phymu_g10038hypothetical protein PHYSODRAFT_515318

Sequence
1610 bases(100 bases per row)
GCGTATCCCACCAGGATGAGCATGTTCCGGGTCACACTGACGTTCTGCATGCCGTAGCTCTCGAGCAACTCCCAGGCTTCCGGTGTATCAACACTGGAGA
AATGTTCGTACATGAAACTCTCGAACGAATACGTGTGGAACGCCATATAGTAGCCCCATTTCCAGTACACCGGGATCGCTGCAAATGGCACCATGAAACC
TTCGCAAAGCATGAACATCCCGAAGAGACCGGCCCCTAGAGCGATGCCCATAATGTAATGAGGCACAGCGGCGCCTAATAGATGCATCATCGACTCGGAA
GTGACGAGGGAAAGCGTCAAATTCAGGAAGAACGAGCCGAACGAATGCACGCGCGCGAAGTAAACGACAATAAAAGACGCCAATAGAGAGATAAACATGA
TGCCAGGCAACGCACCGAGCAGATTAGCGGTCGTGTAGCTGGCCAGGTGCAGCGAATGCGAACGGACTTCCCGTTCCAGTACCGCTCGTTGCTCtagaag
agcaggaagagctgcaacagacatgaagaccaagaacgcTTGGACGTAGAACAGTAGCGGGACCATAGCGGCGCTCGTGATCTCCTGGTTGGAGCTCAGA
TACATCGTGCCCACCATGAAGGACAGCAGGACGTACATGAGCACACGTATCCAGAAGACGCCGGGGTGGCGCCAATTGTTGGACAAGTTCCTGTGCAGCA
GGACGCCGAATTGGTCCAGTCTTGACGGCCTCATGGCTCGTAGCATGTCGTAGTTAACGAGGTTCGCGTCTCGCGCGGACCGATCTCTGGCCACGTCGAC
GTGTAGACGCTGCGGTTCGGttccttcttgaagcgctcgaacaAACGGATCGAGACGTAACTTGGAGTGGAAGTCCACGTTCACTAAATGCACAAAGTAC
TCGGCCGGGTTCGAGTACATTGGACAGACGTAGCCCATAGAGAAGAAATGCGtgagtgctgctgctgccgggCCGAAATACACGAGCTGACCGTCACTTA
AGATGATGAGGTTGGTCAGCATCTCATAcactgaagacgaaggcTGGTGGATGGTACAGATGACgttcttgccttcttcgtggcAAAGCCGTTCGATGTG
CTGCATCACACTACGAGCAGAGGAAGCGTCAAGGCCTGACGTCGGCTCGTCAAGCAGTAAAAGTGCCGGGTCGGAGAGCAATTCCACGGCGATTCCCAGT
CTCTTTCGCTGGCCGGAAGAGATTCCTTTGTGGAAAACATCTCCGACATTCGCGTGCATGCAACTTCGCAGCCCCATGGCGTCGATCACGTCTTGAACAC
GAGACTCACGCGTGAGAATAGGCACGTAGCTGGGCAGACCAAGTCCTGCGGcgatctgcagcgtctccaatACCGAAAAGGACCCGAGGAACGCCATGTC
TTGAGAGACGTAGTTCATGATGGCGTGGAACGTGCGAGGGTCTCGAGGCTGTCCGTTGACGTCGATAAACCCTTCCACACGGACACAGGGGCCTCCGTTC
GGTACGCGGTCTGCTAAAATGTCGAGTAACGTGGTTTTCCCAGCTCCGGATGGCCCGATGATCGCTGTGAGCTCTCCAGGACCCGATCTCCCCCACACAT
TGTTGAGAAT