Description :
From Genome Similarity Track
Location :
Scaffold_65:258663- 260741
Transcript NameFunction/comments
Hyaar_Emoy2807567hypothetical protein

Sequence
2078 bases(100 bases per row)
ACTCTCGTTTGTGGAGCGCAAGCTGTGCGTTCGGGTGAAGCACTCTTGCCATGTACGTCTGGATGTATCCAAGCGTGACCAGGAGATCAACGCCCTGTCG
TTTAGCATTATATGCAAGTGGTAAGCGGGTTGGTCTTGATGCTGTAGTTTAGCATTATATGCAAGTGGTAAGCGGGTTGGCCTTGATGCTGTAGCTCGAC
GAAAAGCGAAAGGCAAGGACCGTGAGGATGGAGATGCCGATCAAGATGTCAAATAAATCCAAATGCTTTTTGGCATATGACGGATCTCCCCTTTTACAAC
TGGCAAGTCTGATCGAAAGTACATTCCTGCGATCTTGAGGCCATGCCGATGTATGCTTGTTGTGCTTTGTTTCTACGATTTAATGGAATTTATTAAACAG
TGAGCTGAATCAGTACAAACTTTATCAGAGCCCGACCGGGTACTGTGTTTTCTAAATGTTTAAAAGTAGCTGGTCTGCAAACTCCGTCCTGCGACTCTGC
GTTCGAAAATAGCCGGACAAATATTTGAGCTCATGATTGGACACTTTCTCCTTCAACAGACAAGCCACTTCATCGGCACCAAAGCGGATCCCACGGGCAT
TGTAGAAGTCGACATATCGAAGCCACTGCTCGAGGTCCTTGCAGAAGAAAACCCAGTCACGCGGTGACTTATTACCTCTCGCCAACGCACAGGGCATCCC
ACCACATCTAAGCCGCTCGAGTTGCTTGCGGAAGCGACTCCATAATTTCTGTGGCTTATTACGTACTTCCGACGCAAAGGGCATCATGTGAAACACGTCT
CGAGGGGTCCATCCTGGCACCAGCCATAACTTGAATACCAAATTTTTAACTTCTGACGAACGTTTTTCCAAAGTTAATTGCTGCATCCTGTCCGCGCAGA
GCTCCATACCGGCAACGATATGAAGCCAATGAAAAAACAACACCGCCTCATCCCATGTCCTGTGATTTTGTCTGCGCAACATCGCAAATATAGCACTGTC
CTTTGTCTGCTCAGCTAGATCCTTGTCCCTCACTAGCGCTGTTAGAATCTCTTCCACCGGCTTACTTTCACCAAAGTGCAGTAGCAGCAAACGGATGGGC
TCTTCCTTCGGCAGCGCAACTGCACCTTTTTCCATCGGCTGGCTGTCGAAAAGCTGTATCCTGGGAACCACCCGCTAGTGCTTTTTCCAATCGCAGCTCA
TCCGTCATACCGTTGTTAGAGAAAATGATAGAGCGATCCAGAAACTTGTCAGCGTAATCAAACCACTCGAAAATCTTTCTACAGATATTGTCCCACTCCG
CCAGGCCGACATCGCTGGTAAGGGCTCCTCCAAACGAATCGACAGTAGGCTGTAGACTTCCGTAGGGGTCTTGCCTAACTTCAGCCAAATCTCGATGGTT
GCTTTTCGCATGGCTGGATACTTCTCATACAGCAGTGTTTGGAAGGTGTCAGCGCAAATTTCCATATTAGGTGTGTCGGGAAGCGAAGTGGATAGAATCA
ACAGCTCGTTCGCATCTAGATACTTCGCCAGCAAGTCATACGCATATCCTTCATTGAAGTGCGTACTATCACTAATGTACTGAACAACATACTCCATCCA
ACGCATGGGATTGGGATGAGTGGCAAGCAACGTCGTCGCATCTTCGACGCCATGTGTGAGCTGTCCAGGCGCCGTGGCCAACGTCATGTACCGGCCCTCC
GTTGCAATCGGCATCAGGATAAGTTATGCCTCCTCCGGGTCTATTTCAGCGGCCACAAAGGAATCATCTGCTCCAGGGATAATTTTTCAGCAAGCACTCT
TTGAAGAGTGCGAGCGCGGTCTTGCATAGGAGTGTCTTTGAGCGAATAGAGAGCTTTCACTAGCTCTTTCTCTCCTCCTACGCTATTTACGAGAAGCTTT
ACGACAGCAGCGTCGTCGAACGTGTTAAATTGAGCATGGTACCTGTCAGCATGCTGGATCCATATCTGAAGCTTCTCAAGCATGATGTCATCTTTCTGCC
CCGCTTTAGTATCAAGCCGCTTGAAAATCTCTGCTGGGTGGTCGCACAGGGGTTGGAAAGATCTGGAGTTCATGGTTC