Description :
From Genome Similarity Track
Location :
Scaffold_29:258614- 259731
Sequence
1117 bases(100 bases per row)
AAGCGGTAACAAAATCTGACCCCGCTGGTAAATGGAAAGTTGTGTATCTGAATGGATCGACGGTGCACAACCATCCACCTTCGCAGGACGTTAGCTCTCA
CCCGGGACACAGACGCCGTGACATGCAGAAATTAATTTCACAGGAGCTCACAGCTGAGGGTGTCGTAGCTTCTCAAAATGCTGTGGGCATTTCGCCCCAA
GTTGCTGTGGCAATGTTACGTAAATCTCACCCTGATATTTCAGTCACTGCCAAGGACATATCTAACTACAAAAACGCTGAGCGTAGTGAAGAGCTTCGTA
CACACACATCCGTAGAGGTTCTACTGAAGCAGTTGGACAGCAACAAGTTTTATTCCGCCTACAAATTACATCCAGAGACTTCTCGTTTGCTGTATTTGTA
CTGGTCGCACCCTGGCATCATGAAGTACTTTCCGTGGAACTCAAACGTGCTGATTATGGACTGCACTTATAAGACCAATGAGTACGATCTTCCCTTACTA
AACATTATCGCCATGACGAACACGAAGTCTGTCTCACCTGTCGCCCAATGTTGGTTACCTGGTGAAAAAAAAGAAGACTTTGTGTGGGCACTGACACATT
TGCTAAACATGATGACAGCTAATCACATAGCGCTCCGATCGATAATTCTTACAGACCGTGATTTAGCATGCATGAATGCGGTAGATGCTGTTTTTCCTAC
TGTTCCGTCACTAGTGTGTCGTTGGCACATGAATCGCAACGTATTGGCTAAGACTCGTTCAATTTTCGGTCAAATTCAAGTGGAAAACCCATTGCCCAAA
TAAGACAAGTTTGTAAATACCGTTGCCACAGATCAGTTTATGCAGCTCTACTACAACGCTGTTGATGCACCTACCGAAGCTGAGTTTGACGCAAAATGCG
AAGTTATTCGCGAAGCCAGCTCTGAAATGGCAGATTATCTGGACCTACAATGGTGGGAATACAAGACAAAACTTGTTCGCTGTTGGACAAATCAGTATCT
GCATTTTGGCTATCGTGATACCTCACCTGTTGAGGAAACACATTCTAAATGTAAGAAGTGGTTAGAGTCATCTCGAGGCGACTTGTTGACAGCCTTCAAA
AAGCTGCTACCGTGGTG