Description :
From Genome Similarity Track
Location :
Scaffold_53:258512- 275239
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16095hypothetical protein
Phypa_INRA-310PPTG_16096hypothetical protein
Phypa_INRA-310PPTG_16097hypothetical protein
Phypa_INRA-310PPTG_16098hypothetical protein
Phypa_INRA-310PPTG_16099hypothetical protein
Phypa_INRA-310PPTG_16100hypothetical protein
Phypa_INRA-310PPTG_16101monovalent Cation:Proton Antiporter-1 (CPA1) family

Sequence
16727 bases(100 bases per row)
CGGAGTGGAGTTGAAGCCCAGACTTCACAGACGAAGCCCCAGCCAGACCACGGTCGATGTCGCACAGCAGCGGGCAAATACTGGTTTAAAAGCAACAACA
AAAAATAATCACCACGTCAGCAACAATGAATGCAGACAAATGCTTGATACACATACATGGAATCGGGGTGCGTTGTTGGCCATTGAACCCACAAATCTTC
AACTGCGCTAAGAGCACGTTCATGAATCACCACCACACAAATCGCGTCGTATCCACCCGCTGAGAACATCAACACTTCCGGTTAGCTGAATTCACACAAC
TCAAATATACCAGTGCTCATGTAAGCGTACCTCCAGGGACCCCAGCAAGAAGAACACCAGGGATCGCTAGCGTTGCGTCGAGGATAGCAGTCTGCTCGGG
TGGCTCGATAGGGACTCCAGCTGCAGCTCCCATTTCGCTATATAGTGTCATGAACAAAAAGTGTCAGATTATCATCGCATCAGCTTCTAAAACTAAGTTG
AGCTTACCGCATAAGGTCTCGGAAACAAGAAAAGGCTTCACTGAGTTTCAGAAGAACGGCCCCAACCTTAGCGTCTGTCGTACTCCACTATACACACAAT
GGTAAGCTTATCAAACCATTACGAGAGAACGAAAAGAAGGCAGATATGCACCTGTTCACCGCGTTGAGTAGCCAAGGCTTCCCAATTAATGGGAGTGTTG
TCGTTTTCTTCCAGCTCGCAGATTTCCGCAAATCCCTGCTCGACCTCTAGATTGTGGTGGTGAATTTCATCCATCACTCTCTTTGCTTCACCAGGTTGCT
GTTTTTGCCACTTCAACACCTGTCGAACCATTGACACAGTCGCTGAACCAGACGACACGTCTCCCATCAGTAAGTGGAAGCTTGAAGGCAGGCGAACAGG
TTTCTACCGGTACATGCAACAAATTTTAATAAGAAACGATAAAAAGAACCAGCATCAATGTCCGTAAACTGACATACCACGCGGTTGGAAGTGTTCCACA
ACGTATGGTTCGTAATGCAACGCGCAATTTCATTGGGTCTCATCGCATCTTCAGACGTGAATTCGTTCAGAATTGATGCCGGGAAACGCGTATACTGCTG
TGAACCGAAGCAAGCCGCCGAGACATCAAAACCGCTTCCGATCTGTAAAGTTAGTGCAAGTTATTCGACCATACTATCTGGAAAATAATCTGTCGATCGT
ACCTTGCGCTGCACGTAACAGTGACTTAACTGGGCAAGGTTGTGAACCACTTCAAGGTGCTGTTGCTTCTCATCGAAGTTCATGTTTGGCACAAAAAATG
CCGCAAGAGCCGCAACCAGGGACGTCACGAGAGCGGCAGAGCTCCCCATACCTGTCTTTAGAGCAACCTGCTTGCCACCACGCTCTAAACACGACGGTAA
GACACTTCTTTTTTTCACATACTTAGCATCTTTAGGTAACAAATCAAGCCTACCTTCCATTGTGGGAGGAAGGAATGCCTCGAGTGCCCTCAAGTTGTCG
CGACGGAGTGGCAACTTGGCATCTTGCAACTACACATCCAAACCAGGGTCAGCACCATCAAAAATATTCACAATAAGTTTCCTCTCACCCTCTGCACTTG
CGAGTAGAAGTCATTATCACCCCGAAGCGTAACATGAACACCCAACTTCATCCCTTTTAGCCGTTGGAACATATCATTGCTCTTGAACTCCTCCAATCCG
GCAATGCCATTCACCGCACATAGCACTGTCTCCTCGATGTACGAGTTGCGATGCGAATTCTGCCTGTCAACAAACCACAGTCAAAATCTCCTTCCAATTA
GCCACCACAATTTTGGATTTCGTCACCTGAGCTGAAATCGGAATCGTCCGCCGCCATTTTCCTCGATCCAACCGTCAATTAACTGATCAAATTGCTTACT
CTCCACAGCCAACGAGAACAGTCGACGCCATTCACTTGAGGAAGCAGGAATTTCATCCTCATCACCCAGAGTCTGCAATATACGACATGGATCTTAGTGC
TTTACCAATAGACACGTTTTTTTATCCGACTGTCGAAAATGTACCTTGGCTTCCACTTGAGAATAAAACCTCGCAGTGCTGGAGAGAACGAGCCCCGAAT
ACTGCTCGTCCAGCACCACGTACCCTCCAACAAGTAGCACCTTGCCAGGCGCAGACACACATGCAGAGCGAAGATTCATCATGGTTTCTTAGCCACGATG
ATACGATTGAGCTGTTTGTTATCTACCGCCAGCTTCAGTTTGAAATAAAGGGTTAGGTTTCTCTCCGCTTTGGCTGTCACTTAAAGTAAAATCCTCTTAT
CGGCTTGAATTCAAATGTTAATTCGTACCCTTAATTCCAGACTATTTTCGCTAATTCACCACTTGACTACTCGCGCCAATATTATCCGCCGCCTTTATCG
GCCATGGCGTCGTCCTCGGCGCCGTACGTGACGTCACCCACTTCCACCGTCCAGCCTTCAGCACCCTCTCACGATCTACATGTGTCTCTCTTTCTTGCGT
CCAACAGGGAGCACGTCAACCCGCTGCAGCAACGCGCAGCCGCCGCGGCACAGGTGCGTTTCCAAACAGAATATCCACCAAGAAATAGTCAACCACAACA
CTTTATCTAACCTACATTTGTAACTATGCCTTATATTTGCAGGCACTACTGGCCCCGGGACGCTCCATCTCACAGCGAGAGATTCAGGCTATGCTCGAGA
AGAATGAGGCAGCGCTCAAAGGCTGGAACGCGCTCCACAAGCAGCAGCGTACGCGCCGGAATATTGATGCACTGTGATCCTATTATACTAAATTTTATGT
ATTTGTTACACTTGTAGCTGCTAAGGCGAACCCTGTAGAGCACAAGGAGTGGGTGCGGAGATGTCTGGTCTTTCGCCAACAGATTGGGGCCAGGCTCGAG
GTGTTGGCCTCGTTGGCGGACAAGCAGATCGCCCAAGAAGACGAGAAGACTGGAGGACGACGGATATCGCCCAATGCAGCGGCATCAAGACAAGCTGGAG
CAGCACAGAACCCAACGCTGGCAGCTCCTATCGCTGCCGTCCCACAGATTCTACAGCAGCCGAAGCCTACTTTGCCACAGCAGGTTTACGCACCCCAGAC
GATGTCTAATAGCAATCCGGTGGCCATGGCGACGTCGACTTCAGCGTCCATGGCGATGCCAAATATGGCAGCACCAACGCCTCCAACGATGTTCCCGGAG
CCTCCGATGCCCACGGTTGGCTTTGCAACCACAAGCTCGAGTATGTTTTTCCCAACAGGACAGATGAACCCGATGCAGACTTCAACTGGCTTCACTTCAA
GCACTTCGATGGTTGTCTCTGGTGTATCGACGTCGACTCAAGGATACGCCATGAGCTCTGGGGTGCAGACGTTCACGCCCAACGCGTACATGTCCTCCAC
GAGTGGACCCCCGAGCTCGTCCGCTTCATTTATGAACCAGCAAAACTATATGATGGGCGGCGGCATGATGAACCAGCAACAGCAGTTCATGCCAATGCCG
ATGCCAATGAACCTGACATCTTCTGGGAATATGTACGACAACACTTACGGCATGTCCTCGGCATCAACGTCAACGAACAGCGCCAACGGCAACAATAGTA
GCAGTAACAACTTCTCCGTGGATCCGTTTATGACTCCTCTTGGATTTGGCCCCGATACAAGCTTCGGATCAACGGTATTCCCCATGACTGGGATGCCAAA
CATGCCTATGCAGCAACAACAGATGATGGGGTCGATTAACGGAATCAACTTCGGAGCGCAAGGAGCGTCGATGATGCCCAACAATTTTGGATATGGGGGG
ATGGCACCATCATCAGCACCTAATATGATGCAGCAGGCCATTCCGACCCAACAGTTCCAGCCCACACCTCAATCTTTCCAGCAACAAAATCAGCTTCCAG
TGGGGTCCATGAGCATGTCACCAGACTCGGCATTATATGGTGACAGCAACGTAAATATCTTCGAAGGACTGACAGATGATGCCTTCTTTCCAATGCAATG
ATCAACCCTCTCCTCAACTCTGTCGAAGTGTTCCAAGTCGCCGCTTGTCGGTGCGTCGTCTTACTTGCTGAGCTCCTCATAATCTCGCCGAAGCAAGTTG
TATAACCGCTCTCGTCGCACTGACACGTTTGCAGAGGCATGCAGGCGTGAGAGGATGGACAGCGGGAGATTCCGAGAAGCAGCGTTCACACGCCCGACGC
AGTTGTTTCCGGTGAGGACTTGGATTTTGTGCGTTTCCTCCCAGATTTTATGTGTAGTGGCAGCACGAGTCTCTCGGTCAATCAGCAGGTCCGTTAGCTT
TGGCAGGGTGGAATTTTTCTGCTTCGACTCTGTAGATAGTCGAATGGGTGATCGTTGCTGAAGCAAAGCGGATCGATCCGGTGTGGCCTTGGGGACGGAG
CTACGGTCAGGGTTGGGATATTGTGCTGCTGAGCTGTCGTAACTAACTCGTAAACCAGGTCGCGGCTGATTGTATTGACTGGTGCGTTGCGGTGGACTCG
TAAATGTGTGGGAGCGGGTCGGTTCATGCAGCGGATTATTCAAATTTTCGAGGACTGATGCCGTCGCCTGCAGTGTCACGAACTCTGGTACTGGAGGTGC
TGGGTTTACTGTGAGGTTTACTGATGAAAATCTACGTGTAGAAGGATAAAGCAGTGAAAAGCGTTCCGAAGTCGCTGGTACTAGTCGTCGATCACGATCG
ATTTCGCGATACTGTTCAAGGAAAGATTTCGTACATTCGATGTGGAAAGGATCCTGGTTGCCGACGTACTTCTCGTACTGGAAGAGGTCCTTGTGTGCTT
GGAAGAACACTTGGGCAGCTGATACCTCCATTTTTGCTAGCAAACACGTTTGTTGGAAGTATGGAAAGGTGTGACCTATTGATACTTCTTAAGCTGGAAG
AGTCGTTGATCCATTTACAAAGATCAGCATGAAGACAGCTAGCTCCTTGTCTACTCCGCCGACACTTTCTTCATCGCTGTCGGGAACACCTTCGTTCATT
CGCATCGGAGGAGGATCGTTCTCGCCAGGAGACGTGTATGTGGATTGCATCCTTCCTAAAGTTCTCGCTAGGGACCATCAAGCTGAAACAGGCGACAAAA
AGAAAAGCAGTTTGGGCAGCAACACGAGTTTCATGTCCGAGACGGTCGTGCTGCCACTTGGAGAGCACCCAGCTATTCTACAAGCTCAAGAGGAATGTCG
GATCCTCATGAGTGGCAACGACGTTTGCGTAATCGAGGACGAGACCGTCAAGGAAGACGTGGTGCAGATACTAGGCAATGACGCTGAGCTGGTGTTTCCC
GTTCGCAACATCTTTCGCTACCTCGTCATGTTTGTCAAGAACATGGATCTCTTCCTGGAATTTCACATCGAGGTGTTGGACGATACTCAAAAGTATCGAC
AGTTCACTGTGACCAACACGAGATCTCTTGCTCGGGTTGAAGACTCGAGATGCCAGTTGCCTCTCGCGTTTGGCACACACCCTGGTTGGCGCTATCTTTG
CATGGATCTACAAGATCTCACGAGCCAAGCGTTTGGGACTCGCCACGTGACCACGACAAAGGTGCGTGTCGGTGGCAATTGTCGTCTGCTTCGCATGTTT
TTCCAGGACGAACGCTACGCCGACGCCGACCTGCCTGCACACCTCACCTTCCTCGGGTAGCTAGAATCCAAACACATAAGACAAGTAAGACATGCTGTTG
ATACCGGTACAATTCCGTGAACCTTTATACTGTAGTAACTCAGAAGAGCACAACTGTTGACCTGGAAATGCGATCTAGAGCGGCTTACAGATACGACAAA
TTGATCGTATACTGCGGGTCTCGTTGATTGCGTTGACGCGATACCTCTGTGAAGATACGATGGTTGAGCCACAGCGACTCCAGGTATCGGTAGCGAGCCA
TGTCCAGTCGAAGCGGGCGTCCACGTTGAAGTCCGATATCTTCTTCGCCGTAGGCGTCAACGTACGGGCTTGGGAAGTACGCTGCCATGCTGCCTCCGAT
AATCGCAATGCGGCATTGTTCAAGCAGAAGAATTATGCCTACACCGCCTCCACATTCAGCAGCGTGGCGAGTGCATTCTCCTACTGGTGGTCCATGAGGC
ATGAATGCACGTGTACAGCACGAGTCTCCACAGCATAGATACTCGCCACAAATCAAACATAGACCCGGGTCGCAAGGAGCCTTCTCACATCGCGTGCACT
TACGGCCGGCCATCTCGCTATACAATTCGTCGTACTGAGTCGGCAAGTCGATCAGCCGAGGTCGAGTAGGAACTTCGCGTAGGATGAACATGCTAGCAAC
ATAAGCTTCGCTGCAGCCTTCCGTGTGTTCGCACTTGTCGCCGACCTTCGAGCTACCCAGGTGGGTCTTGCTGAGCATACGATCCATGCACCACTGCCAA
ATTTGATCGAACGTCGCGTCTGAACTGCGAGCGATGTCGACTAATGTGGGGATTTGCATCGTTCTGGTAGCTGGTACATTGGTTTCTCCTTCCACCAGGC
AGCGCCAAAAGAGCTTCATACGGCGAACAAACGAAGCGTTGGACGGTAGGATGCGTTGCAATCGCGCCTTGACGTCCGATACCGTGGTGAATGGCTTAAG
CTTCTCAGTTGGATATGTCTTGGCCATTCGCTGCAAAAGCTGGAGCGCAGCAAACGCCTCGGAGTCCGCTTCACCAGACGCTTCCATCACTTCCATTAGT
TGCTGAATGGACCCATCAGCGTTCGTAGAAGACCGAGTAGCCACAGCAGGGCTGATAGCACGGCCACTTCTTGTGCGGCGTGGAGCCAAAGTCGAGGCAC
TTCCCTCCACAGCTGTTGGCTGTTCAGAGTCCTCACTTTCACTAGATGCAACGAGCGAGAACTTATCTTGAAACAGCGAGGTTCCCTCCATCTTAATCGG
CTCGAAAAACTCAGCATGCAGACGCTGCAGCAAGTCCGCAGCAGTAAACACTGGCATGAATTGCCAAATCGTTTCAAGCTCATCTGCAATCACGCTGGCC
ACCACGAAAGCCTGTAGCAACACACATGTCAACGTCATTAGTGGCTTGGCGGCAAGCTCCTCTTCAAATAAATATTATACGTACCGTGAATGTATCTGCT
ACTAGGAGACCCAAAATGGTGCCCCGAAGGCACGCATCGATCGACCCAAGCACCTAATCAAGGATAGAAAAGTTAACATCGGGTCAAACAGCGGGTCAAA
CATTACATAAACACAAGGTAGCGCGTTCCTTACCTTTGTGAACTTCCGGTACTCACGCTTGGTCTCGGTATTGATCGGACAACAGCGTTTAGCGGTTTCC
CAAATCACCTTGGCATCAGCACAGTGCTCCAAAAGTGAGCATGTCCATCGGCAGAATTTTGTCACGGATGTCAATGATTCCAGCTCCTTCTCGAGAGACG
GAGGACACTGGTCCGTCAGTGGATCGAATGGTGCATTGCTCTTAGAAACATTTCGGTGCTCATCTTCAGCAACGGTCAAAAATGAAGCCAATGTATACGC
GCATGAAGCCCATAAGAAAGGAGCACCCTTTTCCAAGCTTCCATGAGGCTCCCAAAGAGTATCCTCGAAGTAATCCCGCCACATATCGTGCTCTGTATCG
TTTTCGTCATCTTCAAATCCTCCATCGCGTCCCAGCACAGAGCGATACCAGCCGGGCATCCACAATTGGTCTCCTACGATCTTGTCCCAGGTGGGAGCCT
TTTCTTCCTCATCCGGCGACGTCACCAGAGAGCGCTGCTGCTCCCGCTCTTCTTCCTTTCTGATCGAGGTTCGAGGCTCAGACGTTGGAATCAAGAAATT
ACTCAATGTCTTGCACAGCGGACACAGGAACTGCGTCATCGCTGAATCCGGATCGATCGCTTGAACGCCATCGAACTCCTCACCGCGCATAGCCTTGTCA
TGTAGTGACGTGATGTAGCGTTCTAGACAGTTAATGTGCACTGCGTGCTGACATGTACGAACATGCAGTCCACAAGGCGTGAGATAGAGCTTGGCACTCT
CGTGAGGACGGCCAAATCCGGGCGGCAGGCGTTCTAAGCGGAAACGATCTTCAAAGTCTTCATCATCGCTGTCATGCATTGTTCTTCCTTGAGCACGCAC
ATTGCCGCCTCTCACGCCAACCATTTCTCGGTCACCCAATCGGCGTGGTTCTACTTGATTTCCTCGTAGATCCAAACGCACGGCCCCACGCATGTCCATC
GGAAAGAGTTGTTGGTCTTCGCGGAGGTCGAGAACGCCTTCAAGAACCTCCAATTCTTCATCTGTCTGCAAGAGCTCGCCTTCAAGCATCGGGATATTCC
CATTTCCAAAGCGAATGCGATCATTGCGAGGGCGACGAGCCGCAGGCGGACGAGGGCTATTCTGTGCCGTGTTGTTACGAGTGAGCTGGTCCTCCAGTGA
GTCATTCATGTACCATTCCGGGAAAGAAGTTGCAAAAGCACGCAAGGTTGGGGACGGCGAGTTTGACACATCGGACGAGGTCGAGCTGCCACCTGAGCAC
AATTCCATCTTCTCGATAACCTTCTTCACGTGACCACGAACCTTCTTACCCTCTGAACCGAGAGCCTCGTTGGGTTCTGGTCTAAAACCTGGGGCGAGCA
CAGTAGACTGATGGACGTAGGCTGCCATGCCCATCTGACCCTGTTGCGAGCCGTCATGACAGAGAATGCAGTTGTAGCAGCGCTTGTTATCCACTTTTTG
GAGTTTCTTCGTATCCTCTTGGGGCTCTTCAATAATCGAAGCCTTGCGCTTACCCAACGCCGAACGTGCATCATGTGATCCTTCTTCATCCATCTTTTCT
TCTTTGTCTTCGTCCGCGAGATCAACCATCGCCTGGAATGCGGCCTGGCGTTTTGCCATTGCAGTCATCGCTCTCTTCCTAGCTTCTAGTTTGCGTTGCT
CCAACGTCATAGGCGGAGAATTGCCACTCTGTCCCGAACCACTTGTAGCCACAGAAGAAGCCTCAGCCTTCTTATGTTTCGACTTGGCCTCATTCGACAA
TTGCTCGAATACTTTTCTGCACGCTGGTGATTCCGTAGTGATCTTCCAAATGAGCCATTCAACTGTTCCAGTTTGTTCACTATCGAGCAATGTTGTCGCT
TGCTCAAGCAGCTGACTCAAAAGATGAAGAACCGACAGCTTGGAGGTAGCAGCGTTTGTTTTGCTCAAGCGTGTCCAGAAGCGGCGGTCTGAAGCTTGCG
ACGCCGTGTGGACGCCGTGCACCAACAAGTGCAAACAGGTCGAGATAACAGCATCGGAGACGCTGTTCTCCGAGCCTGATGTAGATGCCGATCCAGCGTG
CGTCGAGGACATTACCTTCCAAAGAATTACCTGCACAATCGCAACTGTGCTTTCACACGTCAGAATCGCTTGGACTGGACGAAAGAAGTCAACAGGAGGC
TTGGCAGGCTTAAGCGGTTCCTTCGGGGGAGCGTCAGGGGTCGCTTTCTTTGCCTTCTGACGGCATGTATTGCGATAGGTTGTCCAACGATCACGTGCTA
GCTCGTGTGCCTCGCGGTTCAGGTGAAGGAAGTACGGATTGTAGTTCTCCAGCAAACCCTCCTTCAATTCATACCGGCCAGGTTCCAGTCCCGACGGCGG
CACAAAGTTGGATACCTTTGCAAGAACGCTTTCCAGCCGTGGAGCAGGAATATCATCTTGACCTGACGGCAGGATGGCAAGATCAAACAGCTTGCTAAAA
CATTGTGACTTCGAGCACAACTGCTGCAACATCTCTTCCGCCAGGAACTCATTGTCGTAGGCCGATCCAGTAGCGCCTGGGAGACTTGTGCCGAGTATGA
TCACGAGACGTAGAAACTCCTCTAGCATTTGTAGACGTTGTTGCTCATCGATCCCTTGTTCCAGCTCTGCATACCCGAACTGTTTCACCAAATCGTCGGG
CCCATTCACATTGGATCCATTGGGTAGAATGAAGTAGCTACCCAATTGGAATCGATCAACCATTCGTACCACGAGGGCATCTGGACCAGTCATGAGGACA
CCAAGCTGCAGCATCAGCGTGTCTGCATCACGGTAGTGGATGCAATATGGCAATGCCGAGTAATTGTACAGTTGCGCCAGCATATTTTCATCTCCATTTC
GACGCCACAGGTTCGAGTGGATCTGGGAAGCCATCACCAAACAGCGAAGAGGCATTTCCACAAGTTCCCATTGCTTGTCAGCTGACAACTTGTCAAACCC
AAACGCCCTCAAAAGTTTTTCCGAAGGAATTGAGCTTCCTAAACCTGACTGGCTAATACAGATATGCCGCACTGCCGCGGTCAGGAAACGGTGCAAAGGG
ATGTGCAGAGAAGTCGGTTGAGCCGCTACATTGAAGTCGTACGCCATGATGCCTTTTTCTCGACTTCCAGCACCCCTCTTGCTCATAGACACAAGTTTTG
CAACTGGAACCAGCGTCTTTTTCGTCACCTTTTCATTGAGTCGGGTTGACGATGAAAACGTGGCCTCGATGATCGGGCCGAATATCTCCGCTATCTTCGC
TTCAGGTGCTTCAAACTGGGACGGACTAAAACCATTCCAGGAGATCGCGAACACCGAGTGAACACGGATGCCAAGATTAAACATCGACAGCCAGCTATCT
GATTCGTATTCCACGTGATTTTGATGAATTCCTCGCCGCACTTGAGGATCACCACCCTATGATCAACAACACGGAACAAGCCGCTTAGTGGTACATTTTT
AACATAAGATAACAGCTCTGTAACTTACCTGTAAAATACTCAGGCATGAGAGCCAAATCTTCATGTTGTCTGCGTTACACACCAATTCGTTGGACAGAGT
GCCGATGTTGAAAACGTATTCCATGTTCTCCACGCAATGCTGCAGCATAAGCAAAAAACGAACAGGAGGTGTGAAAGTGAGAGTTCAGGAAAGATACTAA
GTCTCTGGAGTGGCAAAACTTACCTTGTACTTCTGGCTGCTAAGAGCAGGGTGGTCAGCGTTCAGCTTCCCTTCCTTTTCATCGACAGCAGATTGAAACA
CCGTGTTGAGAGCATACAGCAATTCACGAATCAACTCTAGCCGTCCAGGGTGCGCAGACGCTTCCTTCTTCGTGTACTTTTGAACCAGATGAGGTACCGT
TAAGAACTGCACGGCGAAATCGAAGATGGAATCACTGGAATTGCCCAAGCCACGAAGGAACATACTGGTCATCGAGGCGTATGATAACAAATATGCCTCC
AGCATGCTAGCACGAAACTGGATATCTACCAAGTGTTCGCGCAAAAGTGAGTGCGAGCGCTCGACAGCAGTCTTTCGTAAAGTGCAATCGTATCGCATTA
GCAGCATCAGAGCTGATAAAGTTTTAGCCGAAGTACCGGAAGCAGTCGTTTGCTCCGACGTGAAATACTTGGCTACCACAGCGTCAAAACTTTTCCGGAC
ACTCTCGTGGCGGCGATACGAGGAACTTAGCGAAACTGCCTTGACAAACTCCTCAATAAATATGTTCTTGCAACTAACGCTATTCCCTTCAGCGAGGAAT
CCGGTAGACGCCACCGCGGTTGTGCTGCCTTCAACATGGAAATCGAAACGGTGTTGCTGGTCTGCTTCTTGTTCGCGTGCCCACGTCCAAACGTCCTTGT
CTCCAGAGATCAAGCCACTAAGCACATCCAAAGCATGATTGTGTAGCCGAATGCTACATTCCTTGACAAACTCCTGAATCGTTTTGCCCTTAGCCAAGCT
GCTTGATACCGGCATAAATCCTCTAAGAGCAGGAGACCGCTGTTTCTGAAGTGATTCAGACACGAGCTCGCTGAGTCCATCGGAGCTGGTACTTATCGAC
TGCAGCCACTCCAGAAGAGCGGGGATACCTTCCATTTGCTTCTCCCACCAGGTAGGAGCGACAGAAATATTAAGAGACCGACGCATCAAATTTCCGACAA
TACCAGGACACTGCAGCAACGGCTTGGTTGAAACAGGCGCATCACCCTCGTTATCTACTTGGCTGACAGCAGAACGCGCTTGGGGCTTGGACATGCCCAA
CTCCACGTAAAGGTGATTGGTCACTTCGTTCACCGAGTGAACGTCGTCATTGTGCAGCCGAATTCCAAAAAGCACTCCAGCCTTCGGGTCGTCGTCAGAG
CTTGTAGACTTGCCTTCAGCTTCGTTTGCCTGCGCCTCAAGCCTGCCGCCCGGCCCAATAGCTCTGGATCCAGACTCAGCAGTAAACTGCGCTGAAAGTC
TTGAAGATCGCGTCAACTCCGCTGAGGAACTCGTCCTGCTTTCAGTAGCATCCGCCACATCTGTATCACTCTGGATCGGCAGAAACTTGGGCGGAATATC
CCTCGTAAACAGCTCAAAAGCCTCAGCCAACTCGAGTCCATAGTGTGTTCCTAGTAACACCTGGTAAATGTGATCCACCACTGCATCGATCACCACAGGC
GCCGTTTGTCCAATATGCTTAGGCAACTTGTGCTTCTTGGCTCCAGTCTCCGCTGTCTCTGTTCCTTTATGCCTCGAACAAAATCCACTCTGCTTCCAAG
CCTACAAATTAAAAAATAAATAAAAGGTCAATCGTCCAAAAATATAATAAAATCTCAATAGTCCTACATGAACATCTCCGCAGTCACAGGAGCTGCCGGC
CGTCGTCCTCTGGAAGTACACGTCGTGACCCGCATGGTCGCTGTGTGTGAAGCAATCCTTGCACATGACGCATGTCGTATCAAGCTGGCAGTTGCGGCAG
CTGTAGGCGATCTCGTCGGCCGAAAAGATGGCACCACATACACGCTTGCGCTCCGTACGCGGGAGCTTCGCCAGGATCTGTGTCGGTGCTAGAGCCTTCT
CCTTGCCGTGTGCACAGAGAGACGTGATCAGCGTATTGCAGACGCTCTTCATCGATTGGCCAGAGACTTCTGTGACGCCTCGTGCCAAGTTACTCTGCAG
TGCGAAGCGCATGAGCTCCAAAAATTCTTCTTCACGGTGGCGTGCGAGCTTCTGCTGGGGCGTGAGACGTGCCGCGGGTACGGCTTCGGCCTCCTTGGAT
GCGGACACCTTGGCCTTGGCTGCCTTGGGCTTAGCCGTAGCCTTGGCCTTCTTGCCGCGGATCGCTACCATCACTCTTGCAACAATAAAGAATAAAAACG
GAAGTGAAGAGGCTGAAGAAGCTTCTGGGCTGGGTGATTTGGTTTCAGTATGCACAGATGCAAATCCAGGATGTTAAGACAGTACCGTGCATATTTTAAT
ACAAGCCTCTTTCTTCGCTGGACCAGAACGCGGATAGCATTAAGTGCGATCTCGGTGGTCGGCGACGCTTCAAGATACAATAATTGCGATGGTAAAGCTG
AGAGCCGCGGGGGGCGGGAATTGGTACAAAGAAGACGGTTGGCCGTGGCTGAGGATTAAAGAGCAACATAGTGGAGAATCGTAAGTGCCGGGTATATCTA
CAGCCTGGAGTGAGAGCATTGTGCTAATTTTTCTGAGTGGCAGGAGCAGCAAAAGCAGCCTGGTGTTGGACAAATGTCTGCTGCGCAAGGGAAGCTGGAA
GGAGCTTGAGGTGGAACTGCAAGGCCATAAGAGGGGAATCATCAGTTTTGAACTGTGGGTTGGTAGGTCCAAAGCGACAGATTTCCTGCAGTTTGTCATG
GGGTGGAACGTGGACTTGGCTCAATGGATTCAGTCCGGTGGAGCAAAACGATGGTATGGGATCCAAGCGAGCAGCCAAGATACTTCAAGTGAAGTGGCGA
AGGGGCCAGAGCTGTGTGAAAATGAGACAGAGTTGCAGAGTTCTGCAGCTTACATATGCGTGGATATTACCGATGTTGAAGACCCAGTCGTCGAGAGTTC
GGATTTACCGCAACAAGATACTACGATGGAGGCAAAAGAAGCGCATCCCGCACAGAAATCGCCGTTTCAGTTTGTTATTCCTCGTTACTCTCTCGTCAAA
AGCGGAAAACTTCGTGCAGTTCGCATCGGAAAAATCGTACATGAGGTAAATTTTTGCCAGATTCCTCAGGGGATATGAATGACAAGTAACGGAAATGTTT
CTGTTGTTCTTGTCGAGGATAACAGCTTCGTATAGATACTTTGTACGACTTGCTGCCATGGACGCTCTACGGTCACAATACTACAAGATGTCACCCAAGT
GCTAGCGCTAATAGATCGAAATATCCCAACGACGAGATAGCAAAAGCATTGATTCTGCTACAGCTCTCGTGTCAGTACGCAAACTACTGTGTTGGTGAGC
TGAATCGGTATTCAAGGTTCGTGCGCATGTTGACAACATCGAACTGATTCCTCCTTTACTTACCTCTTCTGATCTTTTATCGACAGCAAGCTCGAGAAGC
GAAATCTCAAGCTCAAACGGAATATTAACAGAATCAAGGAACGCCATAAACTCCTTAAAAAGAAGAAGGTAAACCTGCAACATGAAGCTGAAGTCTTAAG
TTGCTCGCTGAGTGGAATGCAATCACTACTGGAGGGTTTGGACCCAGAAACGCTAGCTCGACTGCACGCCGAACACCGCTTTGAACCTGGAGATGATTAA
AGATGTAGTTGGCTAGTGTTATTTGACCCACAAGACTCAGATTGCCACTTAACGAGCAGTGTACATTCCTATAAACTCCCTCACTATCCCTCCTTTTTTG
TCCCTTTAGTAGTGGCTGGTTTCCCTGTACGACGATGAAGCCTCTCCTCTCGGATTCGGCGAACACGCTCACGTTTTTCCTCCATCTCTCGCTGGTGCAC
TTCCTCCAGCTGTCGTTTGGCATTCTCACGCTGTTTACGAGCAGACTCACGGATACGTAGCTCACGCTTCTTTTTATCTTCTTTCAGCTTGAGCGCGGCC
TCCCTCCTCTTTTCGTAAGTAAGGACCTTACCCTTACGTTTGCTACCGCCTGACTGGTCTGGTGTTATGGACGCTGGAGATTTTCCTGTTTGATCTGGAC
TTGCAGCAACACTGCTCGGTGTGGAGCTCAAAGAAATAAGAGGTGGTGGAGGAAAGTGCCCGATTCCGCTAGCTGGAGCATTCGCCCTCGGTTTTGGCGT
ATTGGCACCACTATGCGAGCGAGAATGCGGTGGTGAAGGCGATGGCGGTCCGCTCGAGGCACTTTCATCAATCTCCGGCACGGGAGCGAGCTCCGTAAAG
ATATTCTCCGATGACTCCACTCTAGGAATCTGGCGCTTGTGCTTCTCTTCGCGCACTTTCGCTGCCTCTGCCTGGAGCGCTTGCACCTTGCGCAATCTTG
TCTCCTCTTCCTCACCTGTGTGCTGTTCCTGTACACCAACCTTTTCCATTTCCTGCTCTGGTTTGTTCTCACTCTCCTGTTCCTTTTCCTGTTCGGGTTC
TGGTCGATCTGTTGTGGCTTTAAGCTGCGGCACCTTTTCCTCCGCATCTTCAGCCTTCCTAGCAGTAGCATCTCCACTGCTGCTATCCTCTCCAGCACTT
GTGTTGTTCTCCGTTTGCTCCTCCTCTCCACTCTCTTGGGGCTCCATCTAGATGCACGCACAGCCAACAAATCAGCATAATAAATAGCTTCCTGACGCCC
ACCACGTTCACACACCTGCTCAGCAACTCGATGGAGCTTCTCAGCTACTTCGTCCGGCAGGAAAATGTACTCTCCGTCAATCTGCATGTTGTTATAAGCC
TCCAGGATCAAATCTTCCAGCGCTTCGACCATCTCGTCGACCTCTTCTTCGCTCTCTGCTAGGGACATTTCTGGAGTGGCAGCCACCGCCGACGGCTCAC
TGGACTGTGCCGAAGTTTGTGCACCTTCAGTCAACTGTGTTTGGATTGCAGGAGCAGCAACAGCAGCGCCAGTTTCGGCACAGTTGCCGTCTAGTGGCGG
TGTCATTGCTCTGACGCTCCGATTAGGTAATTGCAGCATGGCATCCGCATGGCAGCTTACCCCCGCGAAACATGATAAAGTGTATCTATTCATTTTTGCT
GCCTGACTGCAACATGCAACGGTGATAATCCTATCGACGCTATATGCTTAATTCACACGGCCGCCTCTGCCTGAGCCTTAGCAAGTCGCATCTCGCTCAG
GTCGTCAACGGAGGTCGACGCCGCTGGTCGTTGTGAAGACCTGCCAAACACTGGCTGCATGTAGGTGGTATCGAAGGCTTGCCAGTTGCGGAAAAACGCA
CTTGTCAACGAATTACCACGAGATCTTTCGGCAGCAGGAGAAGCAAGGTTCGGGTCGTCCTCATCATCACTCGTAACGTCGTGGAACTGCGGCCGCGGAG
TCAGGATCGGGACCTCGTCTCCTGTGCCATCACGATTTTCTTTGGGCTGCTCTTCCTCCGGGAACGCCAAGGCACCACGTACCTCACCGTCAGCGTGGCG
AGTGCTGCGTTCAGCTGACCGAGACAGAGTCTCTTCAGATTCTGAAGCAGTTGCAGAGCTTCTATCTGTGTCAGATTGTTCCAGATGACTGTGGTCTTTA
TATTTGCCGGTGAGGTGCAGGTTCATCAGCAACGGGCCCATTAGGCCACCAATCACGATCGTAGTGATGAGGATCACCACAAGAGTCGTAGACTCAATGA
GTCGGCGGTGTGACGCTCCATGAAGGCCGATGTAATTCCAATTTTTAGCCAAAGCGAAGGCCATGGAGCCACGAAGACCTGCCATCCAGATGACACTCAT
GAACTTAACCGGAATTCGGTTTGAAGGAGAGCGAAGGCAGTTGCAGAGGCTCAGAAGCGGGAAAATGTTGCAGAAGCGAGCAACAATGCAGGCCACAAGC
GTCAAGCCAATGAAAGACCAATCGATA