Description :
From Genome Similarity Track
Location :
Scaffold_73:258510- 259832
Sequence
1322 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCC
TGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTTGCAGAGATACTGGAAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAA
TGAACACATCAAGATGACTGTGTTCATGGACGGTCTTCGAGTGGGCCCCGAACGCACTCAGCTGTTCCGGGTGCAGGCAAACACCCTTGAAGAGGCGATT
CAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGTCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCA
ACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGA
AAGACTCCGCAGACGGACCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGG
GGCGCCCTACTGGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGAGACTTAGCCTCTGAGAGTCTTCGCACTCTCGAAATC
GGGCGAAGAGCAGCGGCGGGTTGCTCGGTAGACACCGGATGTGTACGGAGTACCGATCATCTCTTTTAGGATTCTTGATTGAGTCTGGGGCGTCCGAGAA
TTCTCGCACCGCGCCCGATCGT