Description :
From Genome Similarity Track
Location :
Scaffold_24:258493- 260406
Transcript NameFunction/comments
g4812.t1XP_008908818.1 hypothetical protein PPTG_13150 [Phytophthora parasitica INRA-310

Sequence
1913 bases(100 bases per row)
TACACGTACGTGGGGTCCATCCTCATCGCCATCAACCCGTACAAGCAGCTGGACGCCTACAGCGAGCGCCAGATGACGGCGTACTACGGCAAGGCCATGG
GCGCACTGCCCCCGCACGTGTTCGCGCTGGCCGACCACGCCTACACGCAGCTCATCCAGGGAGGCGCGCTGGACCCAGCCAATCAGAGCATCATCATCAG
CGGAGAGAGCGGCTCGGGCAAGACGGAGACCACCAAGATCATCATGCAGTACCTGGCTCGAGCCACAAGCTACAGGAAGGGTCCTGACGGCGAAGCTGGA
GCCCCATTGGTGGAGCCTACAGCCAATAGCGGCATGTCGGGCGCGCTGGGCAAGCTGGAGGAGAAGGTGCTGGAGAGCAACCCGCTGCTCGAGTCGTTCG
GCAACGCCAAGACGCTGCGCAACGACAATTCCAGTCGCTTCGGCAAGTTCATTGAGATCCAGTTCAACCACCACGGCAAGATCGTGGGCGCGCAGATCCT
GAACTTCTTGCTGGAGAAGACGCGCATTGTGTCGCAGAGTTTGGGCGAGCGGAACTACCACATTTTCTACCAGCTATTGGCGGGCGCGGACAACGCGTTG
AGAGAGAGGCTGCAGCTGCAGACGCCCCATGACTACGAGTACTTGCGGAAGAGCGAGTGCTTTAGCATCCATGAGTGTGACGACGCCAAGGAGTTTATGA
CTACTAAGAGGTGCATGGAGACGATTGGGATCACAGGACAGAGACAGGAGATGGTGTTTGAGCTGCTGGCCGCCGTGCTGCAGCTCGGCAACTTGCAGTT
TGCCATGGAGAACGACACGTGCGTGACGCTGGGCGACGACTCGGCCGACGGCATGAAGCTCGTGGCCTCGCTGCTCAAGGTGAGCGAGGACGCGCTGTCC
AAGGCGCTGCTCACGCGCCAGCTGTACGTGGGAGGCAAGGTCATTGTGCAGCAGCAGAACTCGGAGCAGGTCCGGGACAAGCGCGATGCGCTCGCCAAGG
GCATCTACTCGTCGCTGTTCCTATGGCTCGTGTCCGAGCTGAACCGCACCATCTCGCGCACCCAGGACAAGTGGGGCTTCATTGGTGTGCTGGACATCTA
CGGCTTCGAGAAGTTCGAGTGGAACACGTTCGAGCAGCTCTGCATCAACTACGCCAATGAGAAGCTCCAGCGACACTTCAACCAGCACATGCTGGAGGTG
GAGCAGAACGACTACGCCAAGGAGGGTATTGACTGGAAGCACATTGACTTTGAGGACAACCAGGAGTGTCTGGACCTGATTGAGAGCAAGGTGAACGGCA
AGCCCGGCATCTTCATCTCGCTTGACGACAACTGGCGACTCAAGGGCGAGGAAGCGAACAAGAAGTTCGTGTCCAACCTGCACAACTCGTTCGGGCGTAC
GTCTAGCGGACACTCGAGCAGCAAGAACAAGTTCTACGTGCACCCGAAGATGGACGCAGACTTGCACTTTGGTATCAAGCACTATGCTGGCGAGGTCATC
TACGACGCGAGCGGATTCAACGACAAGAACAACGAGACCATGAATGACGATATGAAGGAGCTCATCCGGCAATCCGAGAGCGACTGGCTGCGCGGGATCT
TCGACCTTAACATGCAGTCGATTGAGGCCATCCCTGGAAACAAGCCTCAGCAGCAGCACTCGATCTCCCGTCGTCCGAACGAGATGAAGAAGGGTTTGCA
CCAACAGGGCAACAAATCACGAAACATCCGAGAAGTGTCCGTCAGCGCTCAGTTCCGGTACCAGCTCCAGGAGCTTATGGCCAAGATCTCGCTCGCGAAC
CCTCGTTACGTGCGCTGCATCAAGCCCAACGAATTCAAGCGACCAAGCGAGCTCAATGATACGGACTGCGCGCGCCAGCTGAAGTACTCCGGTATGATGG
AGGCGATTCAGAT