Description :
From Genome Similarity Track
Location :
Scaffold_33:258404- 261439
Transcript NameFunction/comments
Phyci_308577Hypothetical protein

Sequence
3035 bases(100 bases per row)
TGACAGAACTTAGCAGCCGCCCCATTCCACAGCCACCAAAACCAAGTGCTTCATTTAGCAAATCGTTTAGTTCATTTGACGAGGGCTTTGGTTGCGTGCC
CTTGGAACCACCAGCACCGCGTTGATTTGGAGGCAGTACGCTAGATTCCTTAAGAAACTCGGCAGCTGCAACACACATACCCATACCTTTCGGATCACAG
CTAGCCAACAGAACATATACCAACGTGAGGGATCTCCAGTTGCTGTCTGCTGTCGAACTCGTGTGTGATGCCACTGAAGAATGAAGTGACGGCGATGAAG
CTGACGACAGGCGGCTAGATATTCCCCCGGATCCAATGGACGTGCTATAATCGCAAGTGTTATCCAGGAGCGCCAGCTGCTTCAACACAAAAAGTAGTCG
CGTGATTGTTACATGATCAAGTGTTTCCACCGCAAGTAAACGGCACAAGAACATTCGTTTGGGTCGAACGACCCGCAGGACGAACTTGGCACGACGAATA
ATCGCCAGCAGAAGTGAAATGCCGGCTCGAATCAATGCATCACGCTCGTTGACCACAGAAACAGTATCTTCCTCCGGCTCAGCTAGTCGGCTCGAGTCGT
CGGGGTCCGTTTCATCCTCTGATTCAAGGGGTGTCGAAAGTGTTGCCAGTAATACTGGGTCTGTAAGGACGCCCACAATGGTACGTGTCACAGCCGTGCA
AAGCTGGTTGAAGCTTTCCGATGGTGCATTGCGCGTTGTAATGATAGCCGTATTCAGAAGAAGAAAACACTCGCGCACGAAGGCAGGGGAGTGATTCATG
TGGTCACGCAACAGCAGCAGCACGTATTGTGTGGGAAGCTGGCCATGAAATAGCATAGCATATCGTCTGATAACCAACCGTAGACATCGTACGCACAAAA
TCGCCCACTTTTCATCGTGCTCGATGGCAAGCTGATCAGAGAGATGCCAAGCTAATACTATGGGCTCAGGAATTTCATATGTCGTCGTCAAATCAGCCAC
ACGAGGAATTAGATACTCCACAAAGTAATCATTTACCACGAGCTCATCATGCATCGACGGGTATTCCACATAAAACATCTCGTGATCCCACCGCGGTACC
TGCTCCCCAAACTGGGCGACCTCTTCGTCCACATTATTGCTTCGTCGACGCTCTAGTGATTCGATTTCTGCCCCCAAAGCTTGGCGTAGCTCGGCACGCA
TAGAGGCGCGCCAAATGAGTTCCGGATTCTCATGAGTCCGCCGGACTGCCTCAATAATTTCTCGCCAATGTTCCCCTTGTGCACGAGCATCTCCAAGCCA
ACGTTCAAAAGCACCACCACCAAAATTCATAGCGTTATAGGCTAGCGCAACTACTCGATTACGCTTGTTCTCGCTACTCGCGCTACTCGTAGAAGCATTC
GACGTTGCAATAGATGTTCGTCTCGGCTGCTCGAAATCAAACGAAAAGTGTGGCAAAGTCCTTGCACTGCGGGTTGCTGCAGCAGCTTTTGTTTGCGCCA
TTACAGAAGGCGACGTTGTAGTGTGGCGCGATATCAGGTCAGCACGGTTCTTCGCTGGGGTAAAGAGCTCCACGGGGAAAATGCGGTACATTGCCTTCTT
GGAGCGCGTATTACCGGCACAGAACACTTCGACCAGGTCAACGCACAACTCGCGCCTCTTACGCTCTATCGCATTCCCGCCCTCGCCCTCGCCCTCCACT
TCCTTCCCATTCTCTATAGTTTTCAACTGGTCATCCTCCCGCACCGCCGTTGCCAGTGCATAGAGCAATGCGCCATACTCCCTCGCCGACTCCTGCAGTT
CATGCACTTGATCCAAATCCACAACACGAAACAGCTCCCTCACCAACCCAATAGCGAGTTCCATGACGCCATGCTTCCTGTCTCGACAATGACACAAGTC
CAGCAGCGCTACGCGCGCATTCATCAACGCCTCCACAGCTTGCGAGCAGGTCGTCATATCCGTCGCCGCTCTCCTCGACACGAGCGTCAACTGGAAGATC
TTGAGCACTCCCTCCAACACCGCCGCCGCCGCCGCTGCTTCCTGCAGCTCGTCCTTCCCCACCACAGCTCCGTACTGCACCAGCAGCGAGCGCAGCACCT
CGAAGCCCCCGGAGTCTCCGAAGTTGCGTCGATTGGCGGCCTCGCTGCGATCCGCCGCCTTGTCGCCAGCCTCGAAGCCGGGGCAGGGCTTGAGCATGAG
CTCCAGCGTCTCCAGCACCGACAGCACGAGCGAGGGCGACGGCTGGTAGAGGCACGTGAGGAAGGGCTTGAGCGAGCACTTGGCGCAGAGCTTGTAGAGC
TCCCGCCAGCGGATCACGCGGCGGAAGCTCGTGAGCACGAGCTCCGTCATGTCGCGCCCATTGCGGCGCTGCGACTGCTCCGTCTGGTCCTGCAGCAGGC
CGTGCACCACGTCGAAGAGCCGCCGCTCCTTGACGTCGACGCCCACGACGCTGCTCAGCAGGTTCGGGTCGGCGTCCACGGGCACCTGGAGCTGGTATTG
AACAGATGCAGCACAGTAAACATTGGTACACTACAGCGTAAACTATGATACACTGTGCATGTACATGTAGCTGGGCTCACCTCGAGCGGGAACAAGGCGC
AGAAGGTGCGCAGGACTTCCTCCAGCTCGGTGCTGGACACGTTGGCGCGACGCAGCGACAGCACATCGCGCAGCGCGCTCTTCTGCTGCGCGGAGCCGGC
CTGCCCCATGAAGGCGAGCCGTCGAGAGTCGAGCGCCTCCGGATCTGAATCTGGAATTGAAAGTGCAGGCGCCTTGGGCTCACATGAAGCAAGCGCTGCG
AAAGGCCTTTACAACGGAATCGAGCGGGTTTGAAAGGGGAATGTAGGGATAGAGGATGAAGTGAGGGATTTGAATGAGGAGGGTCTTTATTCGGAGCATG
TATGCGAGATGCACAGGTTTCGAGTTGAACTTTTAGTCGAGACCTGATTTGCGGTCGAACATGGGTTCAGAAGTACTAGTATTCACATGAGTCCTCCTGG
GGAGTGTCTTACTTCTGCTTGTTAATGACCTGCTT