Description :
From Genome Similarity Track
Location :
Scaffold_358:2584- 4455
Transcript NameFunction/comments
g9747.t1hypothetical protein

Sequence
1871 bases(100 bases per row)
GAGGAGCATAGTAAGCATGGCAGTCGACACGGCCGAGGGCACTACGGGCGTGTTTCTGCCAAAGCCGACTGCGAAGCGACACTTGCTCATGGCTCCAACA
GTCGACACCGTGAAAAATGGTGCGGTACGAGTCGCAGTTCTGAACGTGGAGGGTAGGCGCGAGAAGCTGCCCGCTCGCGAAGTATTGGGAACTTGGGTTC
CTACTGACGAGACTATGCAACTGCTGGCGATGAACGGTGAGCTGGAGAGGAAGCGAGTAGCTGAATGGGTGGCTGACCTGGAAAAGGACGGAGCCAAACC
GCTGAGTGATGAAGACAGTCTAGATATTCGCGAGATGGAGCCAGCCGATCGGGACCTGATAATTGCTCTTCTACGGCAGTATGCGCAAATAGTAGAAAAG
AAGAAGGGATGTCCACCACTGTCATTAACGGAAGTGGAGCATCACAACAATACAGGAGACGCCGCCCCGATCATGCTGCTGAGAAGGAGGTAGGCTGTCG
CCGAGAACCCGGTTGTAGATAAGGAGGTGGATGAAATGCTAAAGGACGGGGTGATAGAGGAAGGGTCCGGCGCATGGGGCTTCCCTGTCGTGCTCGTGCG
AAAGAAAGACGGCAGCGTGAGGTTCTGTATTGACTACCGGGCGCTGAACGCTGTGACAGTCAAAGATGTGTACCCGTTGCCGCGAGTGGACGAAACATTA
GAGGCATTGTGCAAGTCGCAGCGGTTCACAAGCGTGGACCTCCACGCAGGGTATTGGCAGCTAGCAGTGGCGCAGCAAGACCGACCGAAGACAGCATTTA
CGACGCGACGTGGGCTGTTCCAGTTCTGCCGCATGCCGTTTGGCTTGTGCAATGCACCAAGTACTTTCCAGCGTCTCATGGATTGTGTGCTGCGTGGATT
GACTTGGATTTGCTGTTTGGTGTATCTAGACGACGTAATTATCGTTACGAAAGGATCTGTCGCGCAACACGTAGTGGAATTGGCAGTAGTACTTGAGAGA
ATATCCACTGCCGGGCTCAGTTTGAAGCGGTCGAAGTGTTCGTTTGCTACGACACGCATGGAATATCTGGGGCATGATTTGACGACGAAGGGTATACAAC
CGACAGATCGGTTAGTGAAAGCCGTTGCTGATTTCCCGAGACCAACCAACGCAGCAGATGTACGGAGGTTCGTAGCTCTCGCCGGCTACTACCGACGTTT
CCTACCATCTTTTGGTGCACGCATGTCGCCGTTGACGAGGTTATTGCGGAAAGTCACCAAGTGGACGTGGGGTAATGAGCAGGAAGAAGCATTTAGATGG
GCCAAGGCATAGTTGAGCCGGAAGCCGGTGCTAGCGTATCCAGACTATGGCTTGCCGTTCAAGTTCACAACGGATGCGCCGAAGACAGGATTAGGAGCAG
TGCTGTCGCAGGATCAGGGTAAGGGAGATCAACCGATCGCGTATGCGTCGAAGGTGAACAACCCCACTGTGGCTAAGTACGGCATCTCCGAGCTCGAATG
CCTGGCAGTCGTATGGGCAGTACGGTTGTTTCGGCCTCATCTCTATGGTCGTAAGTTTACAATCGTGACGGATCACGTAGCCTTGAAGTGGTTAATGACG
ACCAAAGAACCAGCTGGACGCTTGCACCGCTGTGCACTCACGCTCCAAGAATTTGACTTCGAGGTGGTGTACCGGCCAGGAAGGGAGAACCAGGTGGCCG
ACGCCCTCTCCAGAGGTCCAGTACCCGTAATAGACGGAGTCGCAGCCGAAGCAGAGGAGGAAGAGGAAGATCCCGCCATTAGCAGACACTATCAGGAGTC
GAAGGAAGCTGTGGATGTCGACCAGTCCAGCACCAACCCCGAGGCCTCGCTGGAGTTGACCGGGTTGCAAC