Description :
From Genome Similarity Track
Location :
Scaffold_632:2584- 4010
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_632-snap-gene-0.6Transmembrane protein

Sequence
1426 bases(100 bases per row)
GCTTTCCCGACACCAAGTAGTTGTCGTAGCTCACAGCTCCTCGCAAGATGATGGTGTCTTCATTCGACGCTCGCGCCAAGCGATTAACGAGTCGACAGCA
CCAGAGTGTTAGTGTGACCAAGCGGCTGAAGTAGAACGGTACGACGCGAACTTGCAAGTGGTGGTCCCAAATGACTCCCTCCCACATGATGCGATCTGCT
GGTCCCAAGTCGCCAAGAATGTTGTAGAGTGTGGTGACGTGCCAGAGGATGAACATGGCGACGACTGGGATCGCGAATCGAATGTGGAAGTTCAGTTTGG
TCTTCATTATCGGAGTGAGCGCGTCCAACGTGAGCACCCAGAGGATCCACACCCACGACGTCGCGACTCCGAAGCAGCGGTGGATGTCCCATTCGTAGAG
GATGCAGAGCGACACATGGATTGCCATCAGTTGAGCCGCGTAGAAGACGAAATCGAACGACGTCAGCAGCGAGAAGAGTAGCTCGCGCTGGTACAAGCTT
GCGGTTGCTGTTGTGAAGCTGATGGTCAGGATGAACGCCAGCGAACCATGTTGCAGCACGTGATGGATGGAGGTATTTGTGGTAGCTGCGTCAACGTCTT
GCGGTGTGACGGCCGTGGTAAATGCTAGCAGAATCCCGCCGATACCGGAGCTGTACAGGAGAACCAGGAGCACGCTCGGGAACCTCGCTTTGGTGACAAT
TTTGACGGGCAGGATCGTCTTTCTCGAGTCGAAGGCATGCTCGTCCTTCTCGTAGCGCATTTGCTGGACGAAACTCGGTCGTCGCGCTCGAATGGTGGTG
CTGCCATTGTTGGAGGTAATGGTCGGAGGAGGAGTTGGAGGCATCGTGGCTGCTGCTACTGCTGGCTCTGAACCGATTTGAACTCTGCAAAGCGCCAGCT
TGACACGACAGCGGAAGATGGCGCACTCGATCAGCTTGCTTTTGCCGCGCCGCCGCCGGAAGGACTTCCGCTTCCGGTAGACGATCTTCATGAGCAGGAT
CATCATCGTGACCAAGCCGTTGCCGACGACGTCTTTCGCTGAGACCTCATAGTGGCTGAAGCTGTTGTGGTACTCCATGATGGAGAAGTCCTTCATGTCG
TCGACGCGGCCGAGCATCACGCACGTGAGCAGCATGAAGACTGTGAATGTGCCGACGACCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGC
TGAGCGTCGATGAGCACGATGTTCTGGAAGCCCGACCAGTCGATGAGCAGCCGTGTCATACGCAGATCCGAGAAGAGCACTGCGACCATCAGGTTGGTGG
TTCCGTTGACGAAGAGGAAGAACCAGAAGTCGTACGTGCGTACGAGAAGCCGCACAACATCGAAGCGCAATGTGCCCAAACTTCCGAGTCCCAGCGGCAG
TCCCAGCAGTGCGCTGGCAAATGCGA