Description :
From Genome Similarity Track
Location :
Scaffold_4:258316- 282697
Transcript NameFunction/comments
Phyke_g470conserved hypothetical protein
Phyke_g471mitochondrial Rho GTPase, putative
Phyke_g472hypothetical protein PHYSODRAFT_469444
Phyke_g473hypothetical protein PHYSODRAFT_469444
Phyke_g474conserved hypothetical protein
Phyke_g475hypothetical protein
Phyke_g476hypothetical protein
Phyke_g477conserved hypothetical protein
Phyke_g478hypothetical protein PHYSODRAFT_552449

Sequence
24381 bases(100 bases per row)
AGCATTGCAATACCACCGTGGGCGGTCCGGAAATTCGAGCAAAGGGCGAGCAGATATGTGCCACTGCTGTCGGCCCGATAAATGAATATTTTCTGGAGTT
TTGGTATCATCGGTATCTTGGCCGGTTTGTGCTGCACTGGGCAATACAACGGCATCGTCAAAAATGCGAGGCGATCCAAGCCAAGACAGCGCTGTGGACG
AGCTCAAAAATTCCAGAGATGAAGACTCGGAGATGCTACGACTAAGGGTCAAAACGCGATCACTCGTTGATACTGACACGGTTGACGGTGCAGTCGACGA
GCTTGAGCCTCTTGATCGACTACAATCTGTTTCAGATAGATCAGGAGATACCTGTTCGTCGTTGTTTTCGTCGCCCTCCCATTCATCGCAAACACTGAGC
ATCGTTGGTTCCGACAGTCGCCGGCCCCTACCGAATCCACGAGCTGACCGCCTCCTCCCATCGTTAGAACAGTTCTTCCGTGGACATTGGTGCTTGAAGA
TGCAAAGAGCGTGGGGTGATTTACAGCAGAAGCGGAACCCGCAACCGCCACACACGACCGTTTCCAAGGCCAGCACGTCAAACTTTTTGTTGCAGAATAA
GCACACCTCCTCTTTCTCAAGTATAAGCCTTGCTGCCGTAGTGTCACGACGCTGCCAGCGATGCGCCAACTCCAGCGGCGAAAGCCGTCGCATGCTCGTA
TCCTGCAAGCGTGCGCCGTGAGCTAGTAGCAGACGCACCATGTCGGGTTGATTGCGAATTACACTAAAATGCAGGGGCGTAAGGCCGGAGTCGTCTCGAT
TATCTATGTCGGCATTGCAGCGGTCAATGGCGAGGCATGCAACGGACACGCGACCATACCAGATAGCGAAATGAAGAATTTCGTTCGCCAGTACGatgct
tgcagctgcattGTAGTGACGACGAGTCACGTGCGCTTCCCATAAGCTTCGTACAAGCGATCCGTTGCCTAAGCGGATAGCCTCGGCCATATCTGGAGGT
AGAGTTCGATGCAGCCCAAAGCCCCTTAGACCTGGAACAGATTCTTCATCACCGTCAGAaaagctgctgtcactgctaGAAGCACAGGTGTCATTGCTGC
TAAGAACCGAAGCACCAACAGTGCGCAGAAAATTTTCGCGAGAAACATACACCGTAGTGTCCTCCGAATCCATCATGGAATTAGGTTGAAGGGCGAGGGC
TTGAAGAATGACTTGATATGGATCCAATTCCCGCACTAGAGGCTTGAACTCTCGCAAGAAGTCCTCGAACGACATGCACATGAGCTTggcctccagcaac
ttgagGATGGCAAGCCCCACTCGCAAGAATACATCCTGCAGCCCCACAAAGAAGAGATCGAAGATGGCGCAGGCGAGATCTGTCTTGGTCGATAGCGAGA
AGAGGGTTGTAAACCATTCGATCCCGTACATGGGGACAGCGAAGCCTTGCACCATTAGGTGGGCATGCAGCTTTGGCAAGTCGCGAATAAACATCTGTTC
GAAATGTTGAAGATACACGTCCAGAAAAGTAGAGCTGCGGTGGTAAATCCCCGCAAGGTGGCGCTTTTTGAGCATGTAAAGGAAGAGTGCGTAGGCATCA
GCTTCTGACAAACCTTCCACAAGGAAAAGCGCCGCGATGAAGTTCATCCCCTGACAATAaccatcttcagcttctgaaATGGCATTCAGCACTCGAAACA
GCGCACTTTGCTGTGCCACaagttggtggtgatgactaCGTTCAAAGATACTGAAAGTGCGTGTGACGTCACGTCCGATTGCGCCCGAGCGCTCGTACTC
AGGTGTAGATATGAGGTAATAGATCTCCTGATGGCGTCGCATGAAATCCCTGGGGAGGACgcgcatcttcatccagttgATGCCTCCGGTTAGCGACAAG
AGCAGCTCCCGCTCCGCTTGGTCTGTGAAGTTGAACTGCTTGACCACATTCCGCCAAAACAGTTGGCGTTTCCTCTCCGGCCCTGGACTTGGTCTTGCTA
TCATTTGAAGCGTCACAGGACTCTCAGGCTCAGACAGATCACAATTGGAGTGGCGACGACGTCTCGTACTCACTGGGAGTTtaccaggagctgctgtaGT
GGAAACGGAGTCTACAGAGTCCGTTGGGTCTTTGGGAATCATCTCGGAAGCCGTTGGGAGCCTAAAGCTGGCGAGATACAAAACGTCTTGTGCTGACTCT
TGTCTCTACCTTGGCACGTCGCGGACTGTCGTCTTGTTCTGCTACGCCAACGGGATCCGCTCGCTACTCGGTCGTCCGTTTCTCGCGAACTGAGCCACGG
CGCTTCAAGGCATACGTCAGGCGGGTTTTAACAATATTGAAAGATAATTGGCTGAAACTAATATATCATTATTATTGGATGAAAATCATTTTTGTTGTGT
GCTCCACACCAAATGTAGGAATTGTATATCACGGGGGGAAAAGATGGCGACCACCACGACCGCCAAGGTGCCTCGCACCGATGAGCGGGAGCACAAGACG
GTGGCGCTGAAGCCGCAGGTGGTGCGCATCGAGGTGTTGGGCGATGAAAAAGTGGGCAAGACGTCGCTCATCTGCTCGCTGGTGTCGCGCCACTTCAGCG
AGAAGGTGCCGAGCGTACTGCTCAACGTGCAGATCCCGGCCGAAGAGAGTGACGAGAACGTTGTTATTTCCATCACCGACACTTCCTGTGCGTAAAATAC
GCGTATAGTATGAATGTAAAATACGAATTGATTGGAGTAATAACATTATTTAATGATTGATACGGTATTGGAGCAGCCCGGGTGTCTGATTTGATGCGAG
TGACGAACGCGGCCAAACGGAGCGACGCCATTCTGCTGGTGTACGACCTGACAAGACCCGAGACCTTCCAGCGGCTACGACGCTGGCTGGACTTTATtgc
caagaacaaggagaTCCCAGTGGTGCTTGTCGCCAACAAAGTTGATATCAATGCTGTTACCCCCACAACTGACGGACCATATGCGAGTCAAGTGAGGCAT
CTGGTCAATACATATCCGGTGAGAGATTTCGATAGAAAGGAGTGGAGATCAAGATGACTGATGCTCGATGTTTTTTTGTTTGGATGCAGTTTGTGGTGTC
AGAAGTGGAATGCTCGGCGAAAAACTTCACGCAAGTGGCACAAGCTTTTTTCTTAGCGCAAAAGGCAGTGTTATACCCCGTAGCGCCGCTGTACAATGAG
AAGAAACGGGTACGCAATGGGAATTATCTGATGTGGTTTAAAGTTTGGTTGCTTAAGAATAAGGTTTATTGTGTGTGTTGCtgtgcagcaattgcaaccC
AAGTGTCTGAAAGCTATCAAGAGGATATTTCGCTTATACAATCAAGATCGCAGTGGTATTCTCAGTCGTGATGAACTGAACGAGTACCAGTATGACTGCT
TTGGTGTGCGTTTACTGTCAACAGAGATCGATACGCTAATGGAGTATCTAGCGTCAGAAGTGCCGTCAGGAGTGGCTCCTGATCGGAGTGGTCTCTTTGT
GGAGGGTTTTATCTATCTATGGTGGCTATTTATCGACCGCAATCGCCCGGAATCGGGCTGGCAAGTTCTGCGTTGCCTGGGATACAACAATGATTTACAC
TTGGAGATTTCTCCGGAGCGTCTTCAGCTGCCTCCGCACGACAATGATGAGTCTGCCCAACTCACTGTTCAGACCATCGAATTCCTAACGAATTTGTTCC
GCCAGTTTGATGCAAACAAGGATAACAATATTGCAGAGAACGAGATTGAGACGATTTTCTCCATCTGTGAGGACGAGCGACCCCCCTGGATGACGTGCTC
AGCTATCTCTACGCCGCTGCTCTACGAAAGAACACTAGTGGATGGCAAACCGACAATGTCACTTGCAGTATGGCTGGCCTGCTGGAGTTTCGTAGCACAG
GAAAACCCACAAAAGCTTCTTGAAACAGTGTTTTATCTGGGCTTCAACGAGAAAACTGTTCCGGCTATCAAATTTATCAAGTACGTATCATTATGTGCAC
TTGTGAAGATTGTGAGGTTGTGACATTATATGTTGCCCATTACTTCACAGGAGTCGAAGTACGACGCGCAAGTCAAATTGGATCGACCGAGATGTGGTAT
CATGCTACGTCTTTGGTTCACCAGAGTCCGGAAAGGAGCATTTTGTTCACatttttgctggtggaaaGAATGCAGTTGCATCAGATGATGAACAGTTAAT
TCTGCGTGCCATTGGTGCCGTTCCTGATCGCGACACGACAAAGTACTTGTTTGTACGTGTGACAACACTTTGAGCCTTTTTGTATATAGTACGCAATGTC
GTAACTTACTTATTGTGCGGGATGTGCTATTCAGATCACGGAACCGCTGTCAGACGATGAATTTGAGTTGAATGCGGATGTACTTCTCTTGGTGATGAAC
CCGCTGGACGAAACGAGCAAAACGTTCGTAGAAGAACTGGATAAAAAGCTACCTGCATCGATCCCACGTGTGGTGATTAGCTACAAGCCGGAGGTTcacg
aagaagacgagatTGAGGCCAAGGAGGACATTGGTGAAGATGGTTCCCTGCTGGGAGAAGACGAACCTAGTGACTTTGCGATTGATGCGACGTTAAAGCA
GTATGCAACGTCGTTGAAGTGCCACGATGCACCTAGCGTCAAATACGCCTCCCGGCTCCTGGTTGCCACTGCATTGCGTCCGTACGTACCTTGTTATACA
TGTTTCTGCGCGGTACTCAACTGACATGCTTGTGCCTTGTGTAGTCCTCAAAATGCGCGCTCCAGTTCATCTCGGTCGTGGGTGCCAGGTACAAAGTTTT
TCCTAACCTTTTCGACTGTGCTGGGCTGTGCAGGGATCGCTGTGGGCGTTGCCTATGCGAAGAAGCCCGACGAGACTAAAGGCGCGATTAAAAGTGTCAT
TGAATCGTTGCGACGCTGAGCATGCTGTCAGACACAATATGATGCCAAAATATACAACAGCGTTGTGTGGCTATTTTTTCTTTTGTTCGAACGGAATTGG
CGTCAACACGAGCCTCGCCATCAACATTACGATTACGCCGTTGTTGAACATCAGTTCTGAGAGGTTTCGATGCCGTTCCGCTGTATTGGCCATTTCGCTT
CTTTTGTGGAAGTCGGGTGAGCATCTTGGCAGGTGAAGCGTGCGTTCCGAATTTGCCAGATTGAGGGTCTCATATATCACCGTGGCCGGCAGTCGAGATA
TTCATTGTTCACACAGGAACGCCTAAGACACTGCAGTCTATCGCATGCCTTGTCGCTGATGATGACTCCACGAGTTGAAGTTACACCAAGTTTACCATTT
GGTCAACTTCTGACTCTTTTTGTTGCTTTTTCTCGGCAGCACCGAGCATGGTGCACGTACATATTAATACCGGTTACATAAAGCACATCTTTGGGCCTTC
AGCTCAGGATCTTTTCGAGTCATTGGGCTCAGGAGTTTGGAATTGGTGATATGAAGACCCCTGTAAAAAGCTCGAGTATAATGATTTTTTTCGTTGACAC
GCTAAATAAATTTTGAGTTCACAGCGTAGAAAAGGAAAGCGGTGCTGTTAAAGgcatggctgctgcagggTCTGGACAAAGGAGCAGGTTGCATCGAGAA
ATCAGTAAAAACTGAGTCTGACACACGATGTAAAATATGAAGCCTGCCCATTTCCAGAGCGAGCCCCGACAAAATTTGATACTGTTCCTAGTGCAACCGT
GTAACACAGCACGAGATCGGCAATGCGAAGACGGACGAGTATGGTGGCAGTCATTCAGCGGTTTAAAATCAATGCATCAGTGGTCAGGGTTGACGCTGGA
TTTGCATTGACGTAATCAGAAGAATCAGGCCTCCACATGACAACCGTAGTACAATACTGTACTACAGTATAGCTTTCTCGATTACGCACGCTGTCTATTT
GGCCCTCCAAAACCAAGCGCATCGTTCCTCCCTCATCTCAGTTTGTAAGGTGCAGGCCAAAGCACAAGTGGCAACGAAGGTCTAGACAATCAATCAGATA
ACATGGAACAAACTGCGGACGAGGTGCCGCAGCTGACACGCCGTAAACCCAAGGCACCCCCGCGCCTCGTTCTAGAGcaggacgaagaggacgaggcCTT
CGCCGCCGTCCCCGTGGAGCAGATGAGCGCGCGTGGCGTGTTCCTACTCAGCATGGCAGTTGTCTCCTTTGCGGCCTTCACGCTCTTCGCACTGGCCGAA
CTCACGCACAACCACCcgcgcttcctgctgtcCGACGTGCTGCAGGGCGAGACCCACGATGTGGCACAATGGGCGTTGCTGCTAGCTGTACCTGCCACCA
GCGCCGCTGCCTGGTTCCCCATTTCCATCTCGCGTGCTACACAAGGTGTGCTCCGCATCAAGTCATcgatgccaccaccaactccagACTCGCCGGCGCC
TTCGTTCTCGCCTACGTCGTCGTTGCTAACCAGACTGGCTCGACGCTACCGTCGCAATCATATGTTTGCGATCTACCAAAGTGTCGGATGGACGTTGTAC
GGGCTGTTTGTCGCACTCCAGCTTGCCTGTTTCACTTCGGACAATCTACGTGCTCTACCGTTTTGTCGACCTGGAAATCGCTCTATTCAAGCCGTGGCAG
CGTTTATTGCCGAGGTGATCATCATTTCGTCTGTGCTGACATTGGAGCGACGACGGGACCGCAACCGACAACGACGTAAAGACAGATTCGTGGTGCAGCt
taacaacttcaacaatatgttgctgctcgttgGTGCCACCCTTCTTGCTTTGGCATCCGAGTACACGCGCGTTTTCCCAGATCCGTCGGGCAGCAGTGTG
GGGTACCCAATGGCTACAGGGCTGGGGTCACTCGCCCTCTTTGTTACGGCATTGTTTAACACGTACGGGTTGGGTGGTATTCTCTCTACGAAGGATGGAT
GGAACTTTTACCAACCTTTTGTGGGGGGCGCACGCTTTGTGCTGTTCCAAGTGGTATCTTGGTCAtgctttggtgctggtgcagccCTGCAGGTACTCTA
TTTGATTTCGTTGGTTGTTGTGGAGGTTGAGCTGTTTGTGGGCGCTATGGCGGTGGCAGGATCACTCTTTGTTGTAGCTCAGATCGTCATGATGATGTCT
TTACTAGTCTTCAAAAAGGCTGTGCTGTCACCTCGAATTGCAGATGACGCGAAGCATGCGAGCTCTGATGTTGCTGACGATCTGGTGGATCCCAATACTT
CTGATCGAGCGTCCAGTCCTGCTGAGAAAGTGGCGATGACTACTTCACCATTGCTGGCAATGCAAGAACGTCTACGTGAATTCACTGATGAATGCCTTGC
CGTGCTTGTCATCGGCGGGCTAGCCAACATTCATGTCATCCCGAACGCTGTGTGTGTCCTGTTTTTCGCGCTCACGACTGATTTGGGTGCCGGTGGTGTC
GCCTACTACGGCTTAATGGCAACAGGCGTGGAGTTTATTATGGTTATATCCCGTTCCATTGCTACGCATATGTATCAGAAAGACTCGCGCAACGGTCTAC
AGAAAGATGTCAACCGCTATCACGTCAAGTACGTGTTACCTCAGATCATTACCGGGTGTCTCCCTGCTGTGGCCGCATACCGCCATTACATCTACGATAT
GGAGGCTTTTGTGCCGGTACTCATCCTCACGATTTTTATCTACATTTACGAGTTCACATATCGCGGTAATCCCCAGCAAACTGGTTGTCGAGAGCGGATT
AGCTGGGTCACCGGGCGCAGCTTTCTTGTGGACACTGTCCAGAAATATTTCAACGGCAAAATCATTCGGATGGCCCCGTTGGACCCGGAGAAGCAATACG
TTTTGAGTTTCCATCCTCATGGCATCATGCCAATATCGGTTATGTGGCTTCAATTTACAGACCAATGGCGAAAGCTCTTCCCGAACTTCTACGCACACAT
ATTGACGGCAAGTGTGCTACATCATCTCCCTCTCGCTCGAGACATACTGCACTTTTACGGCTCGCGTGAGGTCACCAGGAACGCATTCGCATACACGCTA
CAGAACAAAGAAAGTGTGTTGCTAGTGCCTGGTGGTCAGGCagaaatgctggagcagcgaTCTGCACAGAAAGAGGTGCGGGTGTACACGCATCACAAGG
GTTTCATCCGCCTTGCGATCGAGCACGGCGTACCGCTGGTGCCGGTACTGAGTTTCAACGAGGGCGAGATGATGGATAACGTCCAGGCTCCGATGATGCA
GCGATGGttcgtcaagaagctcgcgTTCCCGTTCCCATACTTCCCTTACGGCCGTGGCCTCCTGCCGATCCCACGCAAGGTCAATATTCCGATTGTTGTT
GGAGAACCGTTGGAGGTTCCCCACATCCCAAAGCCCACACAAGACGATGTCGATAAGGTCCACACCAAATACTTCGCCGCGCTAGAAGAGATATTcgtca
agtacaaggacgaAGTTGGTTGCGGTGATTACAAGCTTGTCTTCATTTGAGATGGAACGGGCCGGTAACTCTTACCAGGTAGACTAGAATGCAGCGCAAA
GAAAACAGCATTAGCTATTAAGACAATTATCCATAGACCATTTTGAGGTGTCAGTGCGACTAGACCGCACGACATTGTATCTACGTAAATTTGCTAGTCT
TTACCATTGACCAGTAAGTAGTTAGTGAAATATTGATACCGAGCCCAATAAACAACTGAACTACCCCTCCAGCTTGTGTAGGGCTGCAATGCTGTAAACA
ACACTCGGGTGATCATGAGGCCGTTATCCAGAATGATGCCAACAAGAATGTTTgtccttcaacttgaagtttTTGCACCTGTGCAGCGATATGCCACGCC
ACTCTTCGCGCATGTCAACGTCTTGTTTTGAGATCGTACGACAAGTGGGGTATCGATACGGTGTACTTTGTAGAGCAAGTCAAAGAAGACGGCTCCACGT
GCAATGGCGCGTTGTCGCATGCAAATGAGTCAAGTCAGCGAGTGACCAGTGAGTGGAGCCAAGTTGTTAGTCTGATACTTCCAATTAAATTGGTCTCTAC
GCGATTATTCGAGTGAAACCACTGTCAGAGCTAGGCAGTACGTGTTCTCATGAGTCCGCCAACGTCTCATAGGATTACGCTTTCACCTATGAGCATGATT
GCGCCTGGAaatcaactgcttcattcTGCCCATTACTTCTGAATCATCGtctcacttcgcaatttgcAGGCCAGAGTACAGGTAGGATCTAAGCTCAAGC
CAATCGATCTTCCAGCATGGAAAAACCTGTGGACATGGTGTCGTGTCTAGTGCGCCGCAAGCCCGGAACGCCACCGCGCATCTCGGTAGAGCctgaggac
gaagacgaagccTTCGCCGCTGTCCCTGTGGAGCAGATGAGTGTCCGGGGCGTGTTCTTGCTCAGCATGGCGATCGTCTCCTTTGCAGCCTTCACACTTT
TCGCGTTGTCTGATGTGCTGCAGGGTGAGACTCACGCTGCAGCGCAATGGGCTCTGTTACTAGCTGTGCCTGCCACCAGCGCCGCTGCCTGGTTCCCTAT
CTCCATCTCTCACGCCCCACAAGGCGTGATCCGCATCAAGTCGTCGATGCCACCACCGACTCCAGACTCGCCGGCGCCTTCGTTCTCGCCCGggtcgtcg
ttgctgactAGACTTGCTCGGCGCTACCGCCGCAATCATATGTTCGCCATCTACCAAAGTGTCGGATGGACGTTGTACGGACTGTTTGTCGCGCTACAAC
TTGCTTGCTTCGAACCACAGAATGTGTGCACCTTGCTCTTTTGCCAACCTGGAATCCACTCAGTACAAGCCGGGGCAGCGTTTATCGCCGAGGTGCTCAT
CATTTCGTCCGTGTTGACGTTGGAGCGACGTCGTGATCGCAACCGACAGCGCCGGAAAGATAGATTCGTGGTGCAGCttaacaacttcaacaatATGTTG
CTGCTAGTAGGGGCTACCCTGCTCGCACTGGTGTCTGAGTATTCACGTGCTTTTCCCAATCCGTCAGGTAGCAGTGTGGGGTATTCGATGGCGGCTGGAC
TCGGTTCACTTGCTCTCTTCGTTACGGCATTGCTCAACACGTACGGTCTGGGAGGTgtgttgtcgacgaaagACGGCTGGAATTTTTATCAACCGTTCAT
GGGAGGTGCGCGTTTTGTACTGTTTCAGAAAGTGTCTTGGACGTGttttggtgctggaacagcgctgcagttgctgtaCTTGATCTCGTTAGTCGTTGTG
GAATTGGAGCTGTTCATGGGTGCCATGGCGGTTGCAGGATCGTTCTTCGTGGTTGCTGAAATCGGCATGATGATGTCTTTGCTCGTCTTCAAAAAGGCGA
CATGGTCACCAAAAATCGGGGAACAAGCAAACAATGCCTTGGGTGAGAAGGCGGCAACTATAATGACCGCGAAAGGTTTGTCGAGCCAAATGGATAAGGC
AGTGAattctccatctccaccatcCACAAATGTCGTAGAAATGCACAAACGCCTACGTGGCTTCGCCAGCGAATGTCTTGCGGTGCTAGTCATCGGTGGG
CTAGCTAATATTCAATTCATCCCGAACGCTCTGTGTCTCCTGTTCTTCGCTCTCACGACAAATTTAAGCGCTGGAGGTGTTATCTTCTACAGCGCGACGG
CGATGTTCACGGAGTTCATCATGGTTATATCCCGTTCCATCGCCACGCATCTGTATCAGAAAGACTCCCACAATGGTTTACTGGAAGATGTCAACCGCTA
TCACGTCAAGTACGTGTTACCTCAGATTGTCACTGGTTGTCTCCCTGCTGTGGCCGCATACCGCCATTACATCTACGATATGGAGGCTTTTGTGCCGGTA
CTCATCCTCACGATTTTTATCTACATTTACGAGTTCACATATCGCGGTAATCCCCAGCAAACTGGTTGTCGAGAGCGGATTAGCTGGACTACCGGGCACA
GTTTGCTAATGGAAACGGTCCAGAAATATTTCAACGGCAAAATCATTCGGATGGCTCCATTGGTCCCGGAGAAGCAATACATAATAGGCTTCCACCCCCA
TGGTATTATGACCATATCTGCCATTTGGCTTCAATTTACAGACCAATGGCGAAAGCTCTTCCCGAACTTCTACGCACACATATTGACGGCAAGTGTGCTA
CATCAAATGCCTCTCGCTCGAGACATACTGCACTTTTACGGCTCGCGTGAGGTCACCAGGAACGCATTCGCATACACGCTACAGAACAAAGAAAGTGTGT
TGCTAGTGCCTGGTGGTCAGGCagaaatgctggagcagcgaTCTGCACAGAAAGAGGTGCGGGTGTACACGCATCACAAGGGTTTCATCCGCCTTGCGAT
CGAGCACGGCGTACCGCTGGTGCCGGTACTGAGTTTCAACGAGGGCGAGATGATGGATAACGTCCAGGCTCCGATGATGCAGCGATGGttcgtcaagaag
ctcgcgTTCCCGTTCCCATACTTCCCTTACGGCCGTGGCCTCCTGCCGATCCCACGCAAGGTCAATATTCCGATTGTTGTTGGAGAACCGTTGGAGGTTC
CCCACATCCCAAAGCCCACACAAGACGATGTCGATAAGGTCCACACCAAATACTTCGCCGCGCTAGAAGAGATATTcgtcaagtacaaggacgaAGTTGG
TTGCGGTGATTACAAGCTTGTCTTCATTTGAGATGGAACGGGTCGTTAACTCGTTCTGAGCATGGTATAGCACAAGCCATAAAGACTAAGCTTAGGAACG
ATATATACGCATGCTCAAAAATACGAGATTGGCTTAGTTGACATGGCTTTCTGGGTCTCTGACCTTGAGCAGCCCTAGGCAACCAAACGGAGCCAAAGTT
ACGGGTTGAAGATACCGGCCAATGCTTCAAAGCGACTGCGACGCTGGGTCTGTTCAGGAAATTGCTTCCAAGCTGCCTCCACTTTCGCGGAATGCTTAGA
GAGGTCCAATGGCACGGGGCGTTGGAACTGTTCGGCATATTGATGCCATATGTTCGGCGGCACGAGCGCTGCATACGCCAACAAAATGCACGCCCGCCAC
TTGCCCAGGCTGTTTTCCCACGCGgcgaaagctgcagagtcaCCAAGAGCTTCGCAGGCTCGCACAGACACTTCCTGGACATTTTCGTAGGTCGCTTCGA
AGGCAGCCTCGCACGAAACGGCGTTGTAGaaagcagcatcaaatgGCGGCAGCGATGCGTTCCAAGCTGTAAGCGCCTTCTTCAAAGGCTCCGGTAATTC
GCTCGGGTCCTCGCCACCAATTTCAGCCATGCCGGTGGTGCTTCCACCCGTAGACACCAaatttggagctgcaaatTTCTGCAAAAAGGCGAGGCAGTCC
TGTTTCCGTGGGGGAATGTAGTCGCTTGCAAGCTTTCCTAGCTGTATGCAGCGAGAAAAGCAATACAAATGATGACGTCAGTAAAACAATAAAAGAGTTA
TGACTCCAGCGCTACATCGAAAACGAACCGAATTGGGGATAGTGACGTTTACGTGCTTGTCGCTCATAAGTTCCTTCAGAATGTCCACCGTTACTACGTC
GTTCTCGCACAAATAATGCACGGGGGTATTGCCAATCTGTTCAACGAGAGCAAAAGGAACACAAGATCAGTGACTAGGCATTAGGCGCAACATCCAGGTT
GCAACTCGTACATTGTttttgatgttgaagttggtcttGTGCTTAAGAAGCTCGCGGATTATGAACAAAGTCACACGACTGTTTTGACAAATGTAGTGTG
CTGGAGTGGATTGAAACTGAAAGCACACGgaacaaacaaaaaacaactCAACTTTAGTTTCTGTCCGACACCAACTGATAGGCACAATAGTGTACATGGT
TCTGAATGTTGAGGTTCGTTTTTGCCGCCAGCATGAGGCCAAACATGCGATCCGAGACGAAGCTGTTCTCTGCCAAATAGTGCAGTGGAGCGTTGCCATC
CTGCAGTACCCAGGAAACAACGTTAAATGACAGCATATCAGAATATCCATACACCGATCATAATAACACTTTACCTCATCCATTGCATCCACACCTGGCT
TGGCCTGAAGAAGTGCCTTCAGTGCGTCCTCAGACACCGCTTCATTCTCGCATAGGAAATGAAGCGGtgacttcttgttgtcctGCAATCAACCGTCACG
TCAGCCTAcactccttcaccttcacctaCCACAATGGTTCTACCAACACACCGTCGTCTGCAACTTGGCGTCCGCTTTGGCAGCTAAAAGCTGCTGAATG
CTTGATGTCAGGTTTCCTTCGCCTCCGCTTTTGTTCTTGCACAGTAGATGGAGAGCGCTCCAGCCATTCTACAGGTGTCAAAACACGTTAATATTTTGGT
CATACTTTCATTATATATTATTATATtatcccccccccccaccTCGTCCACTGCGTTGGCGTCAAAGCCAGcgtgaagcagcagtcggAGGCCTTCGACA
CGCGCCGTCGCCTCCACCGAGCGGTTCTCACAGAGGAAATGGAGTGGCGTCCACCCGTCCATCAATGCAGAGGTATCTGACCCAGCATTGAGCGCAGtct
ggagcttcttgggctCGCACGGGCCCTGCACTTCGTCCCACAAGGCCGCGTGCTTGCTCATGAtcgcgcttcttcgttgttgaACTGAGATATTCGATGC
CCTCGTTTGAGTGACAGTCTCGTTTGAGTGACATCCCCGTTCGAATGACATTCTGGTGCAATGCCAGTCGGTAGACGAAGATTCGATTTATCTCAATGAA
GGACCCTGCGACTTGTGCGGCGTTAGACGAGTTCCACACGCACCatgtggagctggaactggaCGTGAATATGATCAAGCGCTGTATCTCTGGCGTCGCC
ACTTTGTCAGTGAAACGTCTCActgctggcgctgcatcAACCGTTCTGTGGCTGGATGTCTTCCACTTGACTATTCGTTCTGTGTGTGCTGCTCTGCCTG
AAGACGAGACAATTGCAGCGCAATGGGCCATCAAACCTTTTACGTCTTTTGGGGAAGTGTTAGAGGTAGAAATCCCAGAAGAGTTGGCTCAAGCGAACGA
CTTTGAGCTCACGATCCGCTACGAGACGAACCTGGAGAGTCCTGGGGTCTGTTggctggagaaggaacagACGGCAGGCAAAAATCTGCCGTTCATGTAC
ACTCAAGGCCAAGAGGTTCTGaaccgcagcttcttcccGTGTCAGGACTCGCCGTCTGTTCGTGTAACGTACACCGCTTCGGTGGTCGTACCGAAGGAAT
TAATGTGTGTCATGAGTGCCAAGCTCTGTGGAGTGGAGGATTATGTACCAGAAGAGGgggagaaggaggtgatACCGACTAAGAAGAGGTTCACATTTGA
GATGAAGCAATCTATCCCAGTATATCTGGTCGCGATGGCAGTGGGAGGCTTGGTCGAAGCACAGGTTGGCCCTCGATCGAGTATCTGGACGGAGCCGTGC
ATGATTGATGCAGCTACAAAGGAGTTTGATGGTGTGCTGGAGGAGTATTTGACCATTGGAGAACGGCTCTTTGGTGAATATCAGTGGGAGCAATATGATA
TGCTAGTCATGCCGCCATCCTTCCCTTATGGTGGAATGGAAAACCCGCGACTCACTTTCGTGTCACCCAGCACGATCGCTGGTGACAAATCACTGGTGTC
AAGTATGAAAATGCTGGAGAATCTGTTGCATCTGATTCTTGATGACTTTGTTACTGAGATGGAATGTTGTGTTGGTTACTTATAACTGTTAGTTGTGGCA
CACGAACTCTCCCACTCGTGGTTTGGGAACTTGGTGACAAACGCAACGTGGAGCGACTTCTTCCTCAATGAAGGATTCACGATGTACGCGGAGCGCCGTA
TTACAGAGGTTTCACATGGCAGGTAAGTGCTGATTGTCGCAACCATGttacttgctgctcttcctttATTGTGGTTCTTAGCGACTCGTACATATTGGGA
ACACGTACCTGTAGACCACTAAGCTGCCTGAGCGCCAAGCTTGGAGAGACATTGCTACGAGAGGAGATTTCATCACTCGGCGAACAATCACCTCTGACGC
GACTGCGGGTACCACTCAACGAAGGCATTGATCCTGGCGACTGTTACAATCAGTGTGCCTACGAGAAGGGCTATGCATTCGTCTGCTATCTTCGAAGCCT
GGTTGGATCTGACGCGGTAAGAAGCTTCACTTTCCTCTTGACCAGTCTTTCGCACAAAAATGCTGACTTTTAAACAACATGTTTAGGTGTTTGACAACTT
CCTCAAACGATACTGCTCGACATTCTGCTTCCAGTCAATCCCAGCCGAAACCATGATCGATTTTttcttgaagagcttcccGGAGCTTGCCAATGCTTCT
GGAACCGATCTCAAGGGCGACATCTCCTTCAACACATGGCTGAATGAACCAGGCTATCCTCGCTTCACACCTGATCTCTCGGATGCGAAAGAAATCATGG
AGAACTGTGAGTCGCTGGCGTTCCACTGGCGCGCATCGACTATCCCGGTGCAGTCTAGTGTGCTGTACCTGTCAgaagaggccaagaagtGGGAGGCTCT
TCCAGTGCTCTACTTCTTGGACTGCTGCCAGGAGACGAAGTTCTCAAGCGCTGACGTAGTGATTGCTTTGGGCGACACGCTAGGTTTGTGGGATTCGCGT
AATTCCGAGATCGCATTCCGGTGGACTCTGATACTGATTGGGAACGGGGTTGTCAACAAGTTGCCGACTGTGCGCACTTTCTTGGAAATCCAAGGCAAGC
AGAAGTTCCAGCTGCCAATCTACCGCTTGCTGACGTCGAGTACAACTTCTGCTATACGTCAGTTTGCCACCGAGACTTATGCTGCTACCAAGAGCATGCT
ACACATCATGGTACGCGACCGCGTCGAGCTGCTACTTGCTGCCATGAAAGATTAacaagctgctcgtgttCGTGTTTTCCGCCGCCTGCTCTTCAACAAG
CTTGGATGCATATTTCGGAGCGACTGCATTATTGACTCTGCTTTTGCAACGTTACCAACTCGATTAATTCCATGAAGTTTATTTTTTTGAGTATTCTCGA
CAACCCAATTGCTGTCTCAATGTATCAATATTAGTTGCTGTCTTGGAGGACGTCTTATTCACAACCAGCTTCAACCAAATTACAATAATATATTTTTTGT
ACCTTTAATTTGGTACATGGTACCAATATTTGAAGTTTCAAAAAGCAGCATTTTCCCATACTGAAGGCAAACagctcagcaatgctgcGAGGGCGGAGGC
GGCTCCGCCAGCGGTAAGTAAACGTGTCTTCTAACGTTTTACGGACTATTGGCTTAACAGAAACATATTACCATGTCGCTGTGCGAATTATCGGCAGTGC
GGAGCGAGAGAACGAGTCAAATGCCAGCGATTCCGACGTGGAGATCGTCTCTGGAACTGCAATGACTCAAGATATCAAGAAATCAAACCAAGCCGAAGCG
TGGGAGTGTCCCATGTGCACATTTCTGAATGAAGACACAGATGCATCTAGGTGTGAAGTGTGCGAGAGTGTGAGACCAGGACTACCGAGGAAAACGCGCA
AATTGACGCAATGGCTATCGGagaagaaacacaagaaacAGTCGCTATTAGGACCTCAAAGCCAGCCCATTGAGATTAttgacagcagtgacagcgatAC
TGCAGTTAGTGTTACTTCCAGTGCAGCTTTTACTGACAGGACAGAGCTGCAGAATGGACAGAGCAATGGcatggcagctgcagttaTCAAAGGACTCTGG
GCAGACGTGTACTCCCCCCAGACGGTGGATGACTTGTgtgtgaacaagaagaaagtgcAAGAGATTCAGGAATGGATTACGCAGAATACGTCACCAACGA
ATAGGTATCCGCAGAAACGattgttgtttttgtgtggACCGCCAGGGGCTGGCAAGTCGACAGCTGTGCGGTGCATCGCTCGACAACTTGGATTGCTTGT
GAAGGAATGGAAAGATAACTCGGCTGCAGGAAAATTGAATTATGACCGCATGCTGCACGAAGAGTTTTGGACCCCGCAGGTGTCAGGAGTTGACGATTTT
TCCGACTTTATTCATCGATCTTCGTCCTACGCAGCACTTCCTGTTGCCACGTCAAGAACCTCGTCATCTACTAGTCGCAAACGAAAACTGTCTAGCAGTC
AAGAAGGATCTGATCTTCCACGTTCGTCGACTGGCAATGCAGGTCAGCTTATTTTAATTGAGAGTTGGCCTCAGTCATGGCCAAGAGACCCGTCACAGTA
CGAGGAAAAGCTTCAACGTATTTATCAGCATGTGGTCGACCCAGCAGGAGGGTGCCATTATCCTGCTGTGTGCATCTACAGTGATACTCAAGGTAGCAAA
ATCGACCTAGACCATCTAAGCCGAAAGTTCTCGCGTGAAGTTATACATTCACCGCTCACATCCGTCATCAATGTTAACGCAGTGACAGCCGCGCAACTCA
AGAAGCATCTCACCCGTGTTGCTGCGCATGAGAACTGTGCGTCTCAACCGGCAGATATCCAGCGCGTTATAGACAGCAGTACTGGCGATATTCGACATGC
GCTGAACATGCTTCAGTTATTACAAGATCCCAgaaagagcaagaaaaaaaatgtgaGTGTCGGATCAAGAAAGAAGAACAAAAATCTCGGCGTCTCTGGC
TTGATCCCGTCTTCGTCGACCGCTCGTGACCCATTTCTCTCAGACTTCCACTTGGTTGGGAAGCTACTGCATGGCAAAACGATCCAGAGCAAGATTTCGA
CAGAGTTGATGAGCGACGTTGACTACGACGAGATCTTGGATGCATCTACTATGCCATTGGACCGGGTGCTTGGACTCGTTCACGAGAACAGCGCTGCATA
TTTCACGCAAGTGGAAGATTTGTCTGGCGCTTTGGAGCTGATGAGTTTGTGCGAAGAGATGATTGCAGAGTCGTACAAGGGTGTTAACAGTTCGGGGGTG
CGTTTAAGTGGTTTAGTTTTGTCTTGCTATCCCAATGGTGCTTTGTATCTCATTAACTTGTGGGGTTTGTTTGCGGGAATCACAGGCTTTCAAACGTTCT
AGAGATGTCGCTCAAGCAATTTTAATGCGTACTATTGCAGTCACAAATGAAAACCCAGCTCCAAAGGCATTCCGTCCAATCACGCGACCGCGGACGTATG
CAGCAAAGCAGCGGATTGTATCGCGACGAGAGGAGATGTTACAGGCAACCCGAGGGGGTGAACTTGGGCTTCAATATGCTTGTACTGGCGATGTGTTTGC
TTTTGAAGTCGAGCCTTTTCTGACGATCATGGACAAAGAAGGTGGACCTGCCACTCGACAACCCAGAGGTGCCAGCTTTACCCTTGATAAGCTCTCCATt
caggaagaagtggacgatgaaATTGAAAATAGTGTTGACGAGTGGTAACAAGTGTCTTAAACAGTTTTGAAATTACATATTGCTACGGCTCAGGCGCTGA
GGTCGAGCTAGCTACACCTCCTatagcagctgcaacagatTTTCTGATGCTGCAATCGTACTCTTTCCTCTTTGCAAAACTACTATTCTTGAATTTGTCG
CCTTGACACTCATGTGTGTTGGCGCTAGTCGAAGGTGTAATCAAAGCACCTGTAGCACTACTAGTGTTCGTAGTCGCTCGATCTTTCTCTCGTTGTTCAA
CGAGTACGCCCAATTTTCCCCTTTTGGGGATATTCGAGGCCCCGGGCGCGACCGCCTTTGGTATGGGAAGGTTCTGGTCATGTGGTAAAGCCAATGCCTG
CGAAGAGACTAACGACGATGACGCTTGATTGACATCATCTGTCGTTGACGACGGCAATTCTAGCAACAAACTCATTTCATGACCCACCCAGCGGACGATA
TACTCGCCATTGCGTTTCCGGTTCAAGTCACCTTGCAGACGTCGTGTTGCTGCATAATGATGACTGTGGCCCGAATTTGGTCCGTTCTGATAAGCTGAGA
CATCACCGTCGCGAAGTTTTTTCTCCAGATTTGCAAGTCGCTGGTGGCAGTTTAGCTGGCCAAGGGAATGCTTATACCATTCGTACAATGTCAGGGCCTT
TGTGAAGCAATTATGTGCACCTCGTAGATTGCCGTTCCGTGAATGAATCATCCCGATTGCACTCAGAGATGCAGCTTGACCAATCTTATTGCCCACCGTT
TTGTACAAGATGAGCGCCGTGCCGAATTGTGCTTTCGCTTCGTCAAACTTCATCTCCGTGGTGAGTAGAATCCCCATAAGCTTGCGGATATTTGCTTGGC
TGAGCGTACTTTTATGCTGTTTAGCGATATGCAGAGCCTTGTTCGCCGCATTCCACGCACCACGGTGGCGACCTGACAAGAACAATGAGTGCGCGAGGTA
GGTCGCCACGTCCTCTACGTAGCTGCTGATCTTATCGCGCAAATTGACGCCGTCGATGATTCCGCCGTCTGCTGCCACCCCACCATCCCCATTCGTTGTG
ATATGAGACGCCCTCGATGATCCAGGCAGTGTTGTCTGGGTCTCTGATTGCCATTCCTCGATCATACGGATGTGGAGGTTCAAAATCATCCACAAATTGG
ATTCGTGCAGGTCCAGGATCAAATACGCAGCACTGGACTGCACAGCCAATGTGCAGATATGTTGGAAAACCCAAAAGCTGACTTTCCGGAAGTGCCTCGC
GGTATTATACAGGAACAGATCGCGGTCTGCTACGCAAAGCGCTTGTAATATGTCGTTCTTggcaccatcgccatcgtaCATGCCAAGTAAGCTGCGCGCA
TAGCTAGCAATGAACGGAAATGTCGAGTAGGATACACAGACCGCCATGAGCTCAGCTTGATCATCCATACGGTCGACATGTTCGGCTACACGAGAAGCAC
GCCCGCTGCGTGTTAGCGTGTTGATCATATTGCGGTCACGTAATATACGGCGAGACCCTCCTTTGCCATTTGGTATATCGTACTCCACGCTGTCAGCCTT
CCCATTCCCAACTGCGTCAGATGCGCTACCAATGAAGTCAGCATAAGATTTCAGTGCTGCTAGCAAAGATTGATCGTATCCACTGGATAAATGTCGCGAT
CTCGAACTTCTCTTCGAACTGTTGCTACTACTAGCCATAGAACTAGTTCCCGTGATACCACTTCGTTTCGGTATGCCACGCTTTGCAATCGCGAACCCTG
CGATACGATTTCGTTGGATAAGCGAGAATCGCAGTAGAGTCTCTACCAATCCTTCCCAGTTACTTCCCCATAAACTTTCAAAATCTGCAGGCATTGCTCC
AGCGGGAAGAAGTCCCAAAAGAGCAAAGAATCGAATTGCATCTTGGCCGTGATGCATGCGAACTTGCTCCAAAGAAACATCAAGTGACGCAACAAGAGTA
TTGAGTGCACTTCGGTCGTGTGACGCGAGGCCTACAACTTGGAGTTCGCTTACACCGCGACTGAGCACTGCACGTGTAAGCTCGGATAAAGATCGATCTT
GGAGTAAGGGGGCACACAGTGAGATTGCTTGGGGGTGACCATCCAGGAATGCCATCAGTGGATGCGACACCAAAGCCTCTAGGATCGATGCAGACGTCAG
CTGCCTGTTGCTAGCATCAATGTCGCCAATTTCAGACACTAGCAAAGCGCGTGGCGACTTCTTAATAAACAGGTCTGCAGCGTGAAAGTGTGAGAGGCGG
TTTAGTGACACAACCTTCTCATCAAACTCGTTGATACCACCGCCCATTGCTTGCCGTGCAGTCATTAAAAATGACAAGGACGGCGtgttctgcagcagct
gtaaCAGAAAGTCTCGAATAGCCGAAGGATTTGCGTTTATCGGATCTTCCATGTTGTCCATGACGAGCAGAACTTTCATATCTGAAAGTGCTTGATCGAG
TGGCATATCTTTTTCTCGCCCAGCTTCAGGGAATAGCGCGCTCTTGATTGTCGATTCCATACCTTCCAGTGACTGGACACCACGTAAGCGAATAAACGCA
ACGCCATCTGCGAAGACGTTACGATCGGCCAGGAAGTGTGCCAATTTAATTGACAACGTACTTTTGCCAATGCCAGGAGGTCCCCGCAGTGTCACAAGCC
GCCGTGTGCTGACGAGCTCAGCTAGCATGTGCAATTCTTGTTCTCTACCCACAAATGATTCCGATACGCCAGGGAGTGTCTTGGAAAACTTGTTTGACGG
ACTGACATCTACCCACTTGCCCACAGCTATGTCAGAAAACACAAAGTGTTGCGTCGAAGCattgcaactgcagctctcCTCGGAAAAGTTCACCTCAATC
GCCTGCGGTGTTTCAGCGCTGGACCACAACGGACACGTTTCCGCATGCAACTGCGAGGATTCCAGCAATACGAACTGGTCACCCTCGCCATCAGGGATCC
GCATCTCCGCGCTGACACGCACACGGGCAATTTCAAATGACTGCTGGACTGTTTTCCCAGTAAGTGCCGCGTGGTAGAACGAGTACGAGAACATGGCGGA
TGattcatccagcactttTCCTTCAGAACGCACACATACAACATGTGCCACCCCAGCTTGGACGAAGACCTCACCGATATCCCTTGAGTCGCAAGACGAT
ACaaacatcaacttcagcgtGCTACTAAGTGTAAGGCGGCCATCAGTACTGCGTGTCGGTGACATCTGCCGAGGTGGGGGACCCAGGTAGCCACCACTTA
GTGGTGGCTCAGCAATCTCCACTGAAACATCACTGGTACTGGTTTCCGCCTCATCTAGAGTTAAGGCTCTTGTCCCGCCACTCAGTATACTGCGCAGAGT
TGTTGCATCTACCAAATGGGCTAGACCGGAGCACTGCGTGTCTTCAAACATGAGGTATTGGCTTTTGCCGACGACACGGCCTCCATGACCACTGAAGTGT
AGCACAGTCACACCTCGGTCTAGAACTTTACGCAGTGAGTCCACTGTTGCAACTGCGCGCATTGTGTGCACTGCACGTTGGCACTCTTGGAAGATCTTGT
TCAAATGGCTCTGTTCCTGTGCAATGTTTAGAGGTGGCACTGGTTTCAGTCGGCGGTTGCTGTCACTCATCACGAACGGCAGCGAGTAGAGCGTCGCGAG
GTCCACCCATGTGTTGTGGATTCCATAGACACTGGACGTTTCAGTGATCGTCGTGCAGTCCGACAGTGTATCGCTCTTGTCTTCACTGGTACTGGCCGTG
GCTGAGCCTCTGCTCGGCTGCCCTACGCCGTCGATCATCTGCCGTGCAATCTGTTCGTTCACGGCCTCGTACATTTTTTCCTTGGCTTCAGATAttgttg
cagcttcaaacccgtcttccttctccagtatTAGTGTCACTCCATTGGTTTCAGTGTCTGTAGAGGTCGCAATAGTTCGAGTATCAGCAAACTCGTCACT
TGTTTCCAattgccttcttcgtgtcAGCAGATCTAGCGCTTGCTCTTGGATTTGACGCAATCGCGCCTCTGCTGACGGAGGTGAATCCGCTGGAGATTGA
GCCAGGGACTCGATGAAGACCCACAGCGCTTGCTGGAGCGACGGAGTCGCAGCAGAGTTCATGGCGAACGCCGAACAAATTGAACAATAACGCCGTGAAT
GATGGTGCATTGGTCACGTGAGTAATATTTGGAAAGCAAATCCTCTTTGAAAATATGAATATAGCGGTATATTGATTCAACTATTGGTTAAGATATTATT
GACTAATGATATCACAATTAAAATAACGAAAGGATTTAACATAATCAATTGAGTCTGTATTGGCCATGAGCGACAGTGAAGACACGAGTCTATGGGGCCG
AACCGAGGAGCGCGAGTTCTCGTACATCGTGACGGTTCCCAGCTCCGATCAGCAACCCAGTAAGATACCACTAACTGCAATCCAAGACCGGGAGATTTGC
AATGGAACACCTGCATTCCCGTCGCATGGACACTGCGTTTGGGATGCTGCCATGCTGCTCGCAGATTATCTGCAAGCTAAAGCCAACAATGGCAAGTTCA
GTTTTAAAGGCAAGAAGGTGGTAGAACTTGGCGCTGGTGTCGGTCTGGTCGGTATGACGTTGGCTGTGTTTGGAGCTCAAGTGATTCTTACAGACCAAGA
GTATGCGCTGCCTTTGCTGCACAAGAATGTGGACGTGAACTTTCAGCAGAGGAGCTGCAAGTTattcgttgctgctgaaatgACTGTTGTGCCAAAGGTA
GAAGTGTGTCAATGGGGAGAACGTTTCCAGTCAGGTGGAAATCTGGAGTCTTGGGCGAAGAACACCGATGTGATAGTCTTCTCGGACGTGTTGTACCATG
CCTCCGCCTTCCTACTGCTGACTGAAACGCTGCATGAACTGACGTCTCCATCCACCGATGTGTTCTTCAGCTTTGAGACGCGAGACAAAACGATCGAAGC
CAACTTCCTGCAGCAACTAAGGGAGACGTTCAACGTCAATGAGATTTCCCGTGAAGACAATGTCCAAGTGTTTGACAGTTTTGAGTACCCTGGGGAGCTG
TTCATTTACCATGCACGACGCAAAGCTGATAGTAAACCTTAGACTAGCAAGAGATCGATACGTTTTCGTTTATCTTTCAGTGGATCATATTATGACAAAT
TGTACGATACCTTGATGCTTTTGCCTCCCGTGAAGAATAAATGTACCTTTATTGATCTCACAACCTTGATATTGTGGTTGAGGACACCACGTCACTAGCC
TTGGGAACCGGTTGCATCTCCTCGACGATGGAAGATGATATCATCCGATCATCGAGTGGCAGGTCCTTGGTCTTCTGATAAACATTGTTGAGGAAGGCAC
AAACGGCATCATTGTGTGCCAATGCTCGTGGggacaacaagaagttgaaCATGTGACTCGCATAGGGAACCTTGATGAAGACATCCTGCACACCGCCTAG
CTTCTTATCCTGGTACGACAGGGGCTCGGAgggaagctgctggcggtAGTGTTGAAGGCGCTTGTAGAACAAGTGCGAGTCGTCGAATGACACCGTGTTG
TCGTGCGTCCCGTGCGTGATCATGAAGGGTGGAATGATATCTCGACGATGCGCCGCACGTTCGTCGTCTAAGTATGCAATTGGCGAGGCGCGCTCAAAAT
CCTCGTTGTtgtccttgagcttcttttGCATCACCAGAAACTCGATATACCGAAGGAAACCGCGGGTTTTATCACGAGCGTAGTATATGCCATTCCGATC
GGTGAAGTCGTGTACACCGTAGTTGTCAACAACTGCACGCACACTTGTGTCGACATCCTCAAAACCAGGCTGGAAAGACTTGTCGTCGGCAGTGAGACCC
ATTAAACTAGATAGGTGGCCACCAGCCGACTCGCCGCCCACTGCAATAAACTTTGGATTGGCATCAAATTCGGCACGAGCGTTGCGGCGGAGATAGGCAA
CAGCACGTTTCGAATCGATCAGGTGCTTTGGGAATGCAACTCCAGGAGACAAGCGATAGTCGATAACACACACTACCCAGC