Description :
From Genome Similarity Track
Location :
contig_27:258263- 260435
Transcript NameFunction/comments
g5939.t1hypothetical protein
g5940.t1hypothetical protein

Sequence
2172 bases(100 bases per row)
CGTCAAGACCGAGTTGCCTACTTTGACCAACGTCCTCAAGTCGAGCTATCACGAAATCCGCTCCAACAAGCATATCGTGAAGAAGCAAATTCTGAATAAT
GTGAGCGGCATCTTCAAGCCAGGCACCATCACGCTCGTGCTGGGCCAGCCTGGATCAGGCAAGTCGTCCCTCATGAAGCTGCTCAGCGGCCGCTTCCCAG
ACGGCAAGAACCTCACCAAGGAAGGAGAGGTGACGTACAACGGTATGCCCGCCAACGAGCTGCTCCGACGTCTACCACAGTTCGTGTCGTACGTGACGCA
GCGCGACAAGCACTACCCGTCGCTCAGTGTCAAGGAGACGCTCGAGTTCGCGCACGCGTGCTGCGGTGGTGGCCTGTCAAAGCGTGAAGAGCAGCACTTC
ATCAACGGCACGCCCGAGGAGAACAAGGCCGCGCTCGACGCCGCCACAGCCATGTTCAAGCACTACCCGGACATCGTCATCCAGCAGCTCGGACTCGACA
ACTGCCAGAACACCATCGTGGGCGACGCCATGACGCGCGGCGTGTCCGGCGGCGAGCGCAAGCGCGTGACCACGGGCGAGATGGAGTTCGGCAACAAGTA
CGTCATGATGATGGACGAGATCAGCACGGGCCTCGACAGCGCCGCCACCTTCGACATCATCACCACGCAGCGCAGCATCGCCAAGCAGTTCCGCAAGACG
GTCGTGATCTCGTTGCTGCAGCCTTCGCCCGAGGTGTTTGACCTGTTCGACGACGTGGTGATCCTGAACGAGGGCCACGTCATGTACCATGGTCCGCGCG
CTGAGGCTCTGAGCTACTTTGAGAGTCTGGGCTTTAAGTGTCCGCCTCGCCGCGACGTGGCTGACTTTTTGCTGGACCTGGGCACTGACAAGCAGGCGCA
GTACGAGGCGAGCTCGATTTCTTCTAAAGTCATTCCACGCGTGGCAAGCCAGTATGCTGATGTGTTCAAGCGCTCTCGCATTTACTCAAAAATGATGGAC
GAACTGCACGGGCCAGTTGATCCGGCGTTGATTGAAGACAACCAAACGCACATGCTTGCTGTGCCTGAGTTCCACCTTGGCTTTTTGGAGAGCACGATTG
GTGTTGTCCGCCGTCAACTGACGTTGCTGTCACGTGATACAGCATTTTTAATGGGAAGAACCATTATGGTGATCTTGATGGGGTTGCTGTACGCAAGCAC
CTTCTACCAGTTCGACGAGACTAACTCGCAACTGGTAATGGGCATCGTTTTCAACGTTGTGATGTTCGTATCACTGGGGCAGCAAGCACAAATCCCCATG
TTTATGGCGGCTCGAGAGGTGTTCTACAAGCAGCGTCGGGCCAATTTGTTCAGCACTGCTTCGTTTGTGCTGTCCAACTCGGTAAGTCAGATCCGGTTGC
GGTGGCTGAAAGTCTGGTGTTCGGCTCCATCATTTACTGGATGTGTGGCTACGTGTCGACGGTGGGAGCTTACATCATGTTTGAGCTGATATTGTTCGTC
ACCAATCTTGCTTTTACGGCGTGGTTCTTCTTCCTGTCGTGTGCGTCGCCCAACTTGAACGTGGCCAACCCGATCTCCATGGTTTCCGTGCTCTTCTTCA
TCCTGTTCGCTGGTTTTACAATCACGAAAGACCAGATCCCCGATTACTTCATCTGGCTGTACTGGATCAACCCCATGGCTTGGGTGTCCGCGCACTTGCT
GTGAACCAATACTCCGACTCAAAATTTGATACTTGTGTGTTCGACGGAGTCGACTATTGCGCCAACTACAACATGACCATGGGCGAGTACTCGCTGACCA
CGTTCGAGGTGCCGACTGAGAAATTCTGGTTGTGGTACGGGTTGGTGTTCATGGCAGCCTCGTATATCTTCTTCATGTTCCTCTCCTACATCGCGCTGGA
GTACCACCGGTTTGAGGCTCCAGAAAATATAACTCTGGACTCCAGCAACAAGGGCGAGGCCTCCGACAACTACGGCCTGATGGGTACACCCAGAGGCTCA
CCAGCCGAGGATGATACCATCGTCTCCATCAGACCCGCAAAAGAAAAGCACTTCGTGCCGGTCACGGTGGCCTTCAAGGACCTCTGGTACACCGTGCCGG
ACCCGTCAAACCCCAAGGACACCATCGACCTGCTCAAGGGGATCAGCGGATACGCGCTGCCCGGCACCATCA