Description :
From Genome Similarity Track
Location :
Scaffold_61:25820- 27331
Transcript NameFunction/comments
Hyaar_Emoy2807230eukaryotic translation initiation factor 2c

Sequence
1511 bases(100 bases per row)
TCCAATGAGTTCGGCGGCCTGGTTTCCCACTTTCCAATTTGGCCCCCAGTGCGCAACTCGCTATCGAATCGTTCGAGAATCTACTACTGCAGACCATGCA
AACAAGTCGTGTCATACTACTGGCGGCCGACGCTTTCCTCGCTTCTACAGAGGCAGCCGGCGCAGTCCGAGTCGCGCCAATTCCTCCGTTCGCCGCGGCC
GATGTCAAGTCCGTTGAAACGGGCTTATTGATAAAGATGTCTGACAAGCTGTATGAATTCCTCGAGAGGGCCGGTCTTTATAGGAGGAATATCTATGAGG
ACCACTTCGCAAAAATACTTGACGAAAAATATGCGGGACCCGCGCTGAATAACATGATCGCGTATAAAAAAGGTCAACGCCTTGACGTAAAGGAAGTTAA
AGAAACGTGGAAGAAGGTTGTACATCCTGCCTCATTGATAATCTGGTAAATGTCTACAAGAATGATAAAGGAACGGTGGGTGACGCAGTGGTAGATGTAG
TAAAAAAGAACTAGATAACGCGCCTTAGGGGTTGTCACGAGCATGGCCTACGACAGACAGACCAACATACGAACAAATACAAAATGCAGCACCTGGTTGT
TATAGTTTCATCGTTATTTTGTTGTTATTGTTGTTATCATAGCGTTCGGTCTACTCTATTATGTCCATCTTATCTTAGTCCTAAACAGTACCAAAGCAGC
AAAACCCAAAGGATACACATCGCAGTGCCTTACTTGCGTCAGCCAATAACCTTTCTTGCAGTAAGAATAGTTTGGTGGCTATTCAGTCGTCCTTTAGTAG
CTTTCTCGAATGTGTCCGAATGCAGTGCAGACACCAGTTCGTGAGAGGATTCGAAAAGTAGGGGTCTCATCAATCTGCCATGTCGAATCGACGACACCAT
GTTGTGGAGTATAGTAGATTATAATGAGGAAACCATCACTTCCAAAAAAGCGACCGATCGCGCAAGAGCCTTCTGATTGGCTGATACTACAGGAAGGGTA
TCACTGGACTTCAGCGAAGCGGAATCCACATGAGTGTGCGTGGACCGAACTCGCCCATGCCAGATCGTGGGGAGGCTGAGTGCGCCTCCGGGACTGCAAA
CCAATCACGCGCACCCTCGCGATCTCCTGAGGGTACGCATATGAACGTCGGGGCGCCTAGTGTGGACACGCCTTCTCCGAAGTCTTCATCACCTGCCGGC
GTCTGGGATCCTGCTCGAGTGTCGACACTTCGGCAGAGTTTTCAGCCTCATGCGTCGGCCCAGAAAGTGCTCGCAGAGACGGATGTATGTCCACGGGCTG
CTCTCGAATCGGAGGAACACGAACACCGCATTCTGTATGAGTGCGCTCGTGGCGAATATTGCTACCGAATGGACGGCCTTCAACGCGATACGTCGTCTGC
GGAGGAGCAAACACTTATGGCGTGGCTCAAGGGCGAATCTGCTGCTACCACCAAAGTTTGTCACTGAGACACATGATGGTGCTGAAAGGGATGAGTTCAT
CTCTTATTTTC