Description :
From Genome Similarity Track
Location :
Scaffold_1673:2582- 3929
Sequence
1347 bases(100 bases per row)
GAGTTGACGTGTATTTGAGTGGGTCAGGGCAAGCTGCCCTGGGACCTAAATAAAAACAGAGTTGATTTTCCTTCAGACTAAGTACTTGGGTTTCAGTATC
ATTGGACTTTGTACGCTTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACATCCAGATCTTCCAACAGCTCATTGATTAGAGGC
ATCGGATACACCATCAATCGAGTCCGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGG
ATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCAC
CCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGG
CTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAATG
GTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCGTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATC
CACCATTGGATCCAAACACCGCGGGCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCAACAGTTGGATCT
AGTCGGTCCTCTAACGAGATTAAGCCCGACGGTTCTGGTTTGACTAGAGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGAT
CCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTTCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTC
CCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCGGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGG
CCAGTTGGCTCCGCCAGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTGTGCCATTCTTTGTAGCGGCGGGATCCCA
CTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGT
GACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTA