Description :
From Genome Similarity Track
Location :
Scaffold_77:258191- 263625
Sequence
5434 bases(100 bases per row)
CCCGTTACACCTGGTAGCACCTTGTAGTCCGTCCAAGGACCACAAAACCCGTTCAACATGAACATGTTGGACGACGAAGGCAACGAAACCTTTCACGGCA
CCCGTGAAAGTTACTCCTATTTGAGCGATGTCGAATGGAGTGCGGTCGAATGAATGAGTGAGACTGTTGGTGAAGAAGCTGTCTGGTCTCTGCTATCCTC
AAGGGATAGGGACCAACAGCATTCCACAATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCGATCTGAAGTGACCTTGCTGCGTCAGCAGGTCACC
AGCAGACTGAGCTCCTGAGACAGCAACAGTCCCAGTCTGCTACTGCAGCGCCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGGCTCCAAGTA
CCGGGGAGTCGAGGAAGACTCCCTGTTGAGATGGTTCCTCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGACGATGAGGAAATGCAAGTTGCATTT
GCCAAATCGAATTTGTTAGGGCGTGCCAGAACTTGTGCCCTGAATCTTCAATTATACGATCCAAACGTGTTTGGATCGTTGGTGGTCTTTAAGACTGCTC
AGCCAAACGTTTGAGCTGCCAAGAGCTGAGTTCAGGACTCTTTCAGAGCATCTAAAGATAAAACAAGGTAAGCATGACGTTCATGCTTACGCTCAGCACG
TTCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGATATTTTTACAGGGCCTCATAGATGGTCCCGTGAGAAACCA
CCTATTCCGCATCGAGCTGAAGTCGCTTGAGGAAGCGATTACAATTGCGGTGCAAGAGGACTTTAGTGTGATAAAGACTCACACTAGCTTGACCCCCTAT
CTTCCTTCGAGACGAGTAGAGGCGGGAGATCCAGAACCAATGGACCTCTGTAATGTCGAGAGCGAGAGACCTCGCTCTTCAAGCATTAAGCGGTTGCAAA
AGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTATGAGTGTAGTGCTTCACGCCTAGTGTCTCGTAACACTGAGCGAAGTGATCAAACGTCTGCCAA
GAAGGGAAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTGGCGGACCGTAAAAAAAACGGTCAGGGTCAGTAGGGCGGAGCGCCCTACTG
ATCCAGCAACCTCAATAGAATTTGCAAATCTCTTAATACGAGTTGCTCCAGACTCACAATCCTTGTGTGTCTGCACTTGGTGATGAGGTACCCCTCATCA
CCTTGAATTTAGAAGTGACAAAAGATCTGTCACTTCATGCCTTAGTTGACTGTGGGGCGTCGAAAAACTTTGTTCGTCGCCAGCCACTATAGGATCGTAG
GCTCAAGTTCGTTGAGCGCGTTACTCCTCGTACGAGGCTGACGGTGCGCCTTGCAACAGGCGCATCGATAGCAGTGATGAAACGTGTAGTGGGATTTCAC
TACACGTTAAAAGATTTGCAATACAATGATGATTTGATCGTACTTAATTTGGATGACAAATTTGATGTCATCCTAGTGTTACTCTGGCTCAGAAGGTACG
AGCAAAGGGTCAGCTGGCAGCATCGAACCGTGAAAATGCCTGCCACTTGTTCATCAGATGGCCATCTGGTGAACGTCTTGGAGCGTCCACAAGCGTGTGG
ATGTACTGCGGGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTACGACTTCACAAGATCACAGTGTGACAACCAATCACACTTTGGAGGAAGCT
GCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTCCGAGTGGATCGAGACATGGGTGTACGCCTAGCGGGCGACATGCAATCAAGAAT
AAACCAGTTGCCCACACAGGGCAACACAACGATCCTAGATCGGCTGGAGAGTCGATCATAGAGGACCTAGCCATGGTAGCGCAACCGCAGCTAGAAGACG
TCGAGGGAATGAGTTTCCACGTAATTAAGGAGAACATTCCTGAAGCATATATTGGTGAGGTAACGAGACCTCATCAGCCTGAGAGAATAAGTCCCCATCA
GCCTGTGGAAACGGGTTCCCAGGAAGAAACCGAGACATTGAATGTCTTGGTTAAGAGCGGGTCAAGTGTAGGCGCATATACACTTGATCTGATCGCGCCT
CCGAAGTTGACTTCGAAGATCACTCAATCGCCAACGCTAGAACCGAAACGGTTCTTGCAAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGTACTCG
TCACGGAGGACGAGTACGTGACTGACATTCGGTCAGCGGGTTCTCAGCAGCTTATCAATGGACGAAAGTGTCCTCGATAAGAAGACTCGGATTGAGCGAT
ACACGTCTCAATCTTGGGAGTCTCTTCAGGCAAATCCATTATATAAGGATTTGACGAGTTCAAGGACGTGTTTCCTGAATCCGTACCATGCGAATTTCCT
AAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAATACTGTGTCATGAAGCAGTGGCCACTGCCTTGTGAACAAGTACTTGCGATCG
ACAAGTTCTTTGCCGATAGCTTAGCTGCGGGTCATGAGGGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAAAATG
GCGGATAGTACAAGTTGAATGCTGCAACGGAACCGGCTCCGACGCCGATACCTAGGAAGGATGTCATTATAGATGGTATGTCAAAGAGTACCATCTTTTC
GTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAATGTGAACGGGAAATCCCATTCAGTCAGTGAGCACCGCCAGTGGTATGCTCTGACCATTGGCT
GGTTGTGCCACAAGGTCTTAGTAATTCCCCATCCACATTCAACAGATGCGTTACAAATCTGTTGATACCGGTGCGAGATTTCGCACCGAGTTACTTCGAC
GATGTATTCGTCCATAGCCGGGCTATGGGCGGAAAGACGGACGTGGAAGTTCATAGACAACACGTTCTTCAGGTTCTTACGCTTGTGCTTGAACGTAAGT
TTTACGCCAACTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGGTGCATCATGAGTAAATCCGGCGTACGCCGTGATCTGGAAAAGATC
AAGGCGATTATCTACTAGCCTGTGCCAGTCGATGTCAAGGGACTTAGAAAGTTCCTTGGGCTAGTGGCCTACTTTTGCACAAGTACTCGCACAACTTCGC
CGAGGTGACGATTCATCTCTCTCGTCTCTTGAAAAAGGATTAGAAATGGTCATGGAACTCTGATTGTTAGCGTTCCTGTGAAAGTATCAAGCAAAACTTG
ATGCATTCGCCCATCTTGGTGATTGCAGATCAGGAAAGAACTTTCCATGTGGTCTTTGACGCCAGCGATTTTGGAATCGGCTGTGCATTAATGCAGTATA
ATGCAGACGGCGCAGAGCGCGTCGTCTGCTATCAATCGCGTCAGCTGCAGCCATCTCAGCGTAATTAACCAGTGCATGGCAAGGAACTCTTTGCCATGAA
ATATGCACTGGATAAATTTCGCGTCTATCTCCTAGACGATAGACCGTTTGTTGTCTATACGGACCATGCGTCACTACGCACGGCCGTAAACAGCCCACAC
CTCTCGCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTTTCCGTGGAATATAAGCCAGAACGACTTAATTTCGTCGCTGATACGTTAT
CGCGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGATGGGCCCACTGTTGCAACACTAGTCTCTAATGTTCCTTCGTCAACACTGGCTGA
CGACATAAAGAAGACCAACGCAAAAGATAAGGCTCTTCTGTGATTGATGGATCATCTGGTTAACCCATCTCGCAAATCTCTCAAAGGTTGCCGGCATTGT
ATTGATCATCCGCGGATCGATACGCAACACGCAACGAGTTGATGTATTACACAGCCATTGCCGGCGACACTCCTCGTATCGTCATTCCCATTCATAATGA
TTTGCGATTGCACATCCTTTATGAGTCACGATGCGCCAAAAGGTGGGCATCATGGTAGAGAAAAGACTTACCCCACGGTAAGTCGCAACTTTTACTGGCC
CCGCCAGTATCAGTTCGTGCGCTAGTACATTCGTGCTTGTGAGGTGTGCCAACAGGTGAAGCCTAGTCCTTTTTTCCGTGCACCACTACAGCCTCTACCC
ATACCGGCAGAGTTCTGGTAGTCCATTTCAATGGAATTCGTCTTCGGGAAACCCAAAGACGCATACAAGAATAATGAAATTCTTGTGTTCGTTGATCGGT
TCAGCAAGATATTACATCTTGCTGCCGTTCAGAATTCGATCATAGCACAGGGATGTACCCGTGTCTTTATTGACACAGTCTTTCGACTACACGGTCTACC
CCGTAAAGTAGTCTCTAACCGAGATATACGGTTCGCGGCAGTATTTTGGCAATCCGTGTTCCGATCACTCGGGACACGGCTGACCATGTCAACATATGAC
CATCCAGAGACAGATGGTCAGACGGAACGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGGGTACGTCCAACATTTCACATATTGGAGAGCGTTCTTGC
CAATGGTAGATTTTGCCATCAACAACTCGGTGCATGTGATCACAACGCATACCTCGTTCTTCTTAAATGGCTTGCGCCATCCACGCCTACCCGCTAACTC
AGAGTGTGACTCTGGTTCAAGGGGGGGGATTCGCTCGAGCGAAAATCATTCTGGCTCTTGCTCATCACGCGTCGAGGTACTCGACGACGCGAACGTTGCC
GATGTCGATCAAGTCGACATCGAAGAAGATAACCTTAGCAATAGTGATGACACTATTGCTGACCCAGATGAGGATGACGATGCTGGTATATTCAGCATCG
CCAACGACTACACTAGCGAGGATGAAAACACCCTCGCTAAAGAAGAGAATGACCCTTTAGCAGTGTACACAAGGCACACTGCAACAAACAAAAGCGAGTC
AGCAGAAACATTTCTGCTGGCACGAGAGGCAGTGGTCCGTTTCGTACAAGACTCCATCGCTAACGCGGTGGATCGGCAGAAACGGAACGCTGAGAAACAT
GGAAGAGCAAACATTCTTCTATTTAATGTTGAAGACTTAGTTCTACTATCTACGTTAAAACTACCTAAGCACGTAGTAGCTAATGTGGGTAGTAGTAAAC
TACTATCAAAGTAGATCGACTCGTTTCGTGTACTACATCGCAAAAGCAATGCGTACACGATCAAGTTGCCTTGCAGGATGTGTACGCATCCTACGTTTTA
TGTCGGTCGTCTCCGCCCGTAGCATCAGCACGAG