Description :
From Genome Similarity Track
Location :
Scaffold_7:258191- 262371
Transcript NameFunction/comments
Physo_129251hypothetical protein

Sequence
4180 bases(100 bases per row)
TGAAGATCCATCCAGACGAACAGCTTCACCACCCACCAGCACGCCTTGGACGAAGACGCAGCGAGGAATTTGCGCGCCTTCCGACTGCCGAGCTGCCGGT
TGGCGATGACCTTGTCGTGCCAGAAGCGAGCGGCATCGATGGCCTCCATCTCGAGCTTCAAAGATGCCAGCGAAGCGTTGCTCTCCTCCACGACGATTCC
ACTCGGGACGAATACAACGGCATTCCGTCGCAGTGCCAGCTTGGGCTTGTTCTTCGGCTGGAACGGGTTTAGCAGAGCGACGAGTTTGCTTCGTGCCAGC
TCCACTCGCTTCTCCAATTTTTCCCGGTCTTCCGGCTCCATGCGCTCGATTAATTCCATTGCTTTGGGCGGTGTTGACACACGCCGGTTAAGCACCACGT
TCCAATACTCCACTTTCTGCTCCCGCTTGTCGTACTCGACCACCCATGCGTACTGCATGATACGGTTGAACTCGATCGTTTGCAAATACAGCAAGCGTGC
CTTCCGCACAGCACCTTCCAATATACGCGAGATCTTGGCGTAAAAGTCTCGCGTGACGTTCACCGCTAGTTGGCCTGGTGGTACGTACTCCTGGCGCAAA
GCTTCGTCTTGGTCGTAGGGCTCGATGTCCTCCCACCGAACGACGACAGAGCGATTGGCCAGAGAGACAAACACAAGGACACTCCCGGTGAGCATCAAGT
TCTGGGTCGACACGATCGTTCCCACGCAGTTCTTCCACTCTCCTTTCAGGATCTTGACCGGCTCGTCGTAATCACACCAAGTTCTAGCAGCCTCCAACAC
TCGAGCCTTTTGCTTCTTGCTCCAGCGCTTCTTCGCTTTAGACTTATCTCCAGATCGCCGCTGGAGGAACAGGGCGCGCTTGATATCATCGAACCGCTGT
TTGCGCGCAGCAATCTCTTGCTTTGTATCGGACTTCAGTGCTGGTGATACGCCAAACACAGCCTTCACCTTGTACGCGATGGATGACCGCACTTTGTCGT
CTTTCTTTCGTTGAGCGCGCGCTGCTTGTGTTTGACGTACAAGCTTCATGTACGCTTTCCCGGACTGCCGAGCGACGAATGACCGGATTAATGCCTGCAT
TTTCGTAGCAGCAAGATTTTGGCGTTGAAGCTCTGCTTCTTGTCGTTTTCGCTCCTCCTCGCGCCATTTCTTCCGCTTTTCCTTTTCCTTTTCAGCATCA
GCATCTCTCTTTTGTTCAGCTTTTAGTCGCAAAATGGAGAAATAGCTTAAGCGATGGCAGTGGTGATACTGTCGTTGGCCTTTCGCGTGGTATGAACTCA
TACAGCGCTTGCAAAAGAGATCCAAACACGTCTCGCATGACCATTGGGCTACTCGGTCTGAGCATTCCACGCACATGACCACTAGAGCTTGGAACTTGTG
TGTGATCTCAACAGGCTGATCCGGTAGAATTTTCGTCTCCTCTTTAGCTCCTTTCGGCTGCTTCTGAAGTCGTTTGTGAACGTGCGGAAAGCACGGATCA
CAAAACGGCACTCTGCCATTGCCACACTGAAGGCACTCTCGTGTTGCTGTTTCCGTACCGCAGTGAATGCACTTCTCGATCTTTCGTGGTTGGTGCCGCT
GAAACGCGTTTCGAGTCTTGTGATCCCTATCGAAGCAGGTTTTACACATAGTATCTTCGCACTCCACGCAATAAACCTCGGCTGGAATCCTTGACGCATT
TGTGCTATCTTCGTGCCGCTCACAGAACGCGTGGAATTCCTCACCAGGGAAAGGCAACGGAACGATCTTCCCGCACACTACCCCCTTCAAGAAGACTGGG
CGCTTTGTGAGGGCCTTTCCGCTGGCAATATGCTGGAACTTCACAGTCCGACCGGTGTGATCGATGAACTCGATAAACATACCGGCGAGCATCGTCTTCA
ATTGCAAGCGAAACTTGTAGCAGCGATACGCTAGCTGGATCGTAGAGGCACATCTGCTGCGGTGCTTCTGTACGTGTTGTTCCCGATAGACGATCACGAA
ATTGTCGTGCATTCTTTTGCTGGTAATTCGGCTCGCAAGTCTCCGCAGAACCGCTGCTGACCACAGCAAACGCTGGGTGCAATGCGCCTCCAGCATTTTT
CTGTATTTCCCGTTCTGGATCGTGGACGGAAGTACGAAGCGATTCATAAACCGAAGAAAGTGCTCGTGGTCGCTACCAGATTCCACCGGCTCAGCAGATT
TTGAAGTTTCTTTGTTGTTTGCATCTGCAAACTTCTCCTTCAGCAACATCAGAATCGCTTTGTTAAATCTCGGGAACGAGATTGTCTTTGCTTTCGGCTC
CTTCATTTTTGCGAAAATTACATCAGCGTTCTGCATGGGAAAGTGGGTCTTGTGGATGAAAGCATGGGGAAGCACTTTGAGAAACCTTGCGAAATGAGAA
TTATCCATTTCGAGCGAATTGCCGGCTGCGTATCGGAAAACCTCCTGCCAAATACCATCGTAACCCTTCCCCTTCCATTGTCTCTTCGCTAGGTCGACAA
CGTAAAGCGATCGGTCAACGCGCGATTCTTCCCGAGCACTTCCATCTCCTTCGTCAGCAGTTCTGATCGCCTTGAATGTAAAACTTTGCAGCAACAGCTC
ATCCTTCACACGGCTGCGGGTCCTTTCTTCAAGTACTTTACCGACTGCGCTCTCCTCAGCTAGGAATTGCCGTCTTCGAACGGCTTCATACAACATTCTT
CTTCCAATAAACCTTCGTGCTGCCCGCTGAATAATTGTAGCATTTAGTGCACGGAAGCGCTGGTTCTCCACATTTCGGCGAGCTATCCAATGCGTCTGAA
TTCGTCGTATCATCTTGATAGCATACCTCATTTGTAGGAGGCGTGTTCGCGTTTTGTATCCTCTCCACACACGCTGAATTCGTCCAGCACTCCTTTCCTT
CATCATCTCCCAAGCGCGAGCGCGTCCTCTAATTCCACGCACGCGTTTTTGTATACAAACTGCGGCTAGTCTGCGTTTGCGATTGACAGCACGCCGTGAT
TTCTCCGCTTCCTTCGCTTTTTCGTATCGAAGGCGCTTACGAATCTGCTTGCCTCTCCATCGAGCCTGTAATTTTCGAGCTGCCTGAGCCTCGCGGGAGT
TCGAGGAATCACCCTGTTGGAATACATTGGCAGCTTTCAGCAGCGAGATCTGCCCCCACATCTTTTGCAACTGCAGCGGAGCGAGGATATTAGACTGTCG
CTTTCGGCGAGCTTCTTCAATCTCTTTTAACAACTGGTTCCTTCGAGCTAAGGCTTCCCGCTTGCGCCGTAAAAGCTCGCATCTGGCAAGGTAGCACCTC
CATGAACACTGCAGAATGCGTACAGCCTTGTGAACGCCACGCTTGTGTTTGCTTACCCATCTTCGAGCTTGCTGGCCCCGATAATGTGCTTGTACCTGGA
GTATCTTTTTCTTGTCACGCTCGAATGCTGCTCGACGACGTCGGAGCATCAAAACTTGCTTTTCTTGCCAACCACGGAACGCGCGCTGTATCGAAATCGC
AGCTCCAAGCATTTTCATGTGTTTTGTTCGTGCAGCAATTTGAAGCGCTTTCTGTCGGCGGCGCTTGTCCACGTGGTCAATTTTACTGAGTAGCATTCGC
TTTCGCTGCGCAAGCATCCGTCGGACGTGCTTTTGGATGCATACCGCAGCTTTATTCCTCCTTTGTTTTTGCAGCTCCCGACGTATTGCCGCCCACTGAG
TGCACAACTGCCTCCAGAACTTCTGAATACAGATCGCAGCTTTCTGCCGTATTACTGCTCGCTCATGTGAACGCTGAAGCGCATAGCGTCGTATGCAGCG
TGTTATTCTGCACGCGGCCTGTTGTCGTTTGCTCGCTAGTAGAGCTAGAAAAGCTGTTTGCCTTCGCTGCATTTCCTTTCGGACTCGTTTGCGCACTTCA
AGCTCATGCTTGGCACTTAGTTGCCGCCACCAGCACTGCAGTCGAATGCTGGACTGATCCCACTCCTGTTCTCGTGTGAAGACAATAAAGTCTTTCCAAT
GACACATTCCAAGGAAAAGAAGCTGGTTTCTTAAACGGACTCCAGCGCGAAACATGACTTCTGCAGCTCGTTGTTGAGCCGGCGACGCAAATTTCCCGAG
CCCGAACGCATAAATGACATCAAGTGGGACCCACTGCTTGATTTCAGCAATGGTTTCCTTCACCTGGTTCTCTGCTGCAC