Description :
From Genome Similarity Track
Location :
Scaffold_22:25819- 27317
Transcript NameFunction/comments
Phymu_g1435hypothetical protein PHYSODRAFT_499448

Sequence
1498 bases(100 bases per row)
CGCCGGACGTCACGTGAAGCATGAAGCCGTGCCAGATCCAGTCGCAGGGGCTCatcgtgctgctgtgtctCGTGAACCTGCTCAACTACATCGACAGGGG
GATCATCCCGGGGGCCCCGCAGAGCTTCCGACACTTCATCACGTCGTCTCTGGGCGTGGCAGTGACGGATCAGTCCGTGTACTTCGGTCTactctcttcg
tccttcatCATCGGCCACTCGGTCCTCTCCATTGTCTTCGGGTACTTCGCACTCACACATCGTCCGTTCCGAATCGTCTCACTGGGGACGAGTATCTGGA
TCGTGGCTATCATCATCTGTGCCATTTCCGAGCACGTCAACAGCTACGCACTACTCATCGTCGGTAGAGTGTTCAGTGGCATCGGAGAAGCTTCGTTCCA
GTGTGTGGCGCCTCCGTTCATCGACCGCCACGCCCCACCGGCGCGTAGAGCGTTCTACGTCGGGATCTACTTGGCGTCTGTTATCGTGGGCACCGCTATT
GGATTCGTGTACGGGTCGCTCTTCGCCGAATCGGCCTTGACATGGGCAGGGGCGTTCTACTTTGAAGCCATCTTGATGGCGTGTCTagtcttctgctgct
tgttctgtGTCCCAGACGAGCTCAACGTTGTGCCGCCTTCGGACGATGAAGTAGCGCTAAGGAAGCCGCTTGTGTCGACTAACGAGTTCGCCAGTGAAGT
CATGTCGCTGTCGAGGGGGAGCCACGATACCATTGAGAAGAACGTGGGCGAGTTGTCGCCGGACAAACTCGGAGTTGAGATGTTGTCACCGGTAGAGTCC
AAGCCGTTCCTTCAGACGTGGTGGGAGATCGTCTCGGACGTCCCGTTCTTGCTGGTAGTACTGGCTCATGGCGCGTACACGTTCACGTTGGGCGTGTTTA
ACGCCTTCGGGCCGGACGTGTTCATCGGACTGGGACTGTTCTCGGACGAGACGTCAGCGTCACTCATTTTTGGCGGAATTGTGGCTGTCACTAGTCTCAT
TGGCACACCCTTAGGCGGGTTTGTGCTTGATCGCCATACAAAACACACCACTGTACCGGGTAAAAGGTGCTTCGTCGCGGTCTCGTCACTCTTGTTCTAC
GTGACGATCGCCGAGGTGTTTGCGTTGATCATGTGCTTCATATCGGACAGCAAAGGAGCGTTTCTCGCGTGCTTCACCATCGCCCTCTTCTGTATGTGCG
CGCTCTGGGGGCCTGAAATGGTCGCGgtgctcgagctgttcccgTCGTCCCGTCGGTCGATGGCCATTTCGGCCAACGCAGTGATCATCCACGTCTTTGG
AGACGTCCCGGCGCCTATTGTCATGGGCGTCGTGCGGGATAAGTGGGCTCCGAATTGCGGTacagtggaagacgacggtgatgCAGTTCTGAATCCGTTG
TGCAgcgaagaccaagacggactgaagaacttcatgctgctgtcggtgctgTGGATGGTCTGGGCGGTCATTCTGTGGGCTCTGGCTATGGTTGCAGT