Description :
From Genome Similarity Track
Location :
Scaffold_2:258136- 261413
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001080Similar to TTC37: Tetratricopeptide repeat protein 37 (Homo sapiens)

Sequence
3277 bases(100 bases per row)
CCGTGAACAGTGCAGAGTGCTTGCGCCTCGTACCAGCTGCACACACCGACATCGTAATGCACTTGCGCAAGATCCGCGCTTGGCGCTGCCTCACTTGACT
TTGTGGAGAGCGCGGCAACGGCTTCGTACGCTTTGCGTCCGTTGGAAATGAACTCTGTCCACGATGCCGACTCCGCGCTGTTTTCCGTTACGTCAAAGTC
ACTTGGTGACAAGTAGAACGCGAAGCAGTGGATGTCGCCGATCAGCTTGAATCCATCCGCGGATGAAGCGATGCCGGACGACGACAGCCTCTTCATCAAA
CTTGACGCCCTCTTCAGATTCCCAGCTGCTCGACCGTACAGACCTTCTGCACACAGATACTTGGCTTGCTTGAACAAGAGTTCAGCATACAACATTGACA
CGACCGATACCTCTTCAGCACTTGTGCAAGGCGACGAGGCGCCAACCAAGGGTTCAATGTGCTCGAACGCTTCGGTAAAAAGCAGCAGTGCACCTTCAAT
TCGCGCCAATTCGCACATGACGCACCATTTCGTCTCACCGAGCTCAATGGCTTTCAAGTACGACTTTTGCGCCGACACCAATTTCCCGAAATGGCGGTAC
ACGTGACCCAGTGTGACCCAGTACTGCGCATTGAACGGATCGTTGCGCAGCACCAAGTGCAGCTTGCCAACCGCACGCTCGTCGTCATTGTCCACCAGAT
GCTGGGCGAGTCGAAGCAGAGCCCACGTCGGCGCTGTCACTTGCTCTTGCGTCGTGTCTTCCCAGAGCTTCACGTTCAGCTCTCGCTTGCCTTGCTGCTC
ATAGAGATTACTCAATGCGATGCCAGCCATGGCATTCCCTGGCGCAAGAGAAAGCGCCTTCAAGAAGCACTTTTCGGCACGCAAAACATCGTGTGCGACG
TCCTGGTAGTATTTGCCCAACCACGCAAAGACCTCGCCGTCGGACGGCATCAATTTGGCGGCCTGCAGCAAATGCCCAAAGCAGTACTGCTTCCCTTGGC
GATAGTTGCCATCGAGATGCCAATAAATGATCGCCAGGCGCTTGAATGCTTGTGCTTTTTCTGTCAGCTTGGATACTGAAATATGCGGTGTTGCAGTCTC
AAGAAGAGCCTTGCCTTCTTCAATAGACCCAAGCTTGAACTGTACCCACCCGCGAATCGACGAGAGCATTGCATTGTCGGCATCTTCGACGGCTTTGCCA
TCTTTCGAAAACGTATCAAGAGCCGCGAGAGTTTCTTCGTACTTGCCCTTTGTGAGCAGCAGTTCCGATGCGTGCACAGTAGCTTGGAATCCAATCGACG
CATCGTCATTCCCGATTAACGCGTGATACGACTCCAGGGCTTTCTCAAAATCGCCCAAGTATTCTCGGGCAGTAGCCTCCATGAGCTGCACTTTTGGCTC
CGAGTAACTACAAAACACAGCAAGGAAAGACTGATTAGCAGTTGGTATAGAGATACTCAGGTACTACGACTTACACAGACGGATGCGGGCTCGAGCAGCC
AAAGAGCTGCTCTTTCTCCTTGAGCAGGTACTTCGCTCTGTTGAGTCGACTCAAACAGCCCTCGATGTCACGCGTGGAAAGCGCGATGGACGCCAGCTCC
ATTTGCGCGCGAACACAGAACGAGCTCTCGTGGAATGAAGAGGACGAGCAGTACGCCAAAGCTTCAACGATAGCGTCTCGTGCCTACAAGCAAGAGCCAC
AGTCACCAACTGCTTAGACTAACAACATACAGCAGGCTCATTGCCGTAGGACTGTTGTTTTGCGTCGAACCTGAACCGTTTCGTTCGCTTCCAGTAACCC
AAAAGCCCTGAAAAGCTGGCTCATGACGCTCTTTGGGTGCGTGGAATGCAGATCCGCCGCAATATCGTAGGCCTTTTCCAAAGTGATTGCTGCACAGCAC
ACGATGTAGAACGCAGATCAACGTCAGTAAGCCGCTGCTTTTCCAAGGGCAAGAGAATAACCATTGCAAGACGTACGACTGTCTGCGTCCTCCGAGCGCA
GCAGCAGGTATTCTGCCGGGATCTTCGCCGTCGGAAACCAGTTGACAATACCGAGTGCCTGTGCATCCAACTGCTGCAGCAGCGCGCGCTTTGCTTTCGT
ACTCGTCGCTTTCACGGCTTTGAGCGCATCGAGGGACGCGCGCACGAAAAACGCGATCGCAGCATCCATTTTCAGTGCCAACTCGGCCGTCTCAGGTGCA
CTTGAAGCCCAATCGTAGCGCGCACTCGCCGCGAAAAACTGGTCCGCGATCTCAGCAATGGACAACGCGGTTGTGCAGTCCGAGAGACTGAAGTTTGGTC
GCTGCAGCCTCACAGAAAGTACCAGGTTAGCAGGAGAGTCGCATTTTGAAGCAGAAGCGACAGAGTCGGCTGTTACCTGGAGAAGATCGACCAGATCCAG
CCAGATGACGGTCGTCGTCGGCAGCTCCTCGTTCGGAGTCACGGCCAAAGAAACTTCGCTGTTACCTTCAAAACCAGCGGGGCTAACAAGCGAATACCAC
GCATCAAACGCCTAGCGCCGACAGTATCATACAGAATGAGTGTTTATTAGTCAAGCAGTATTGCCTCCGTTGTAGATGGACTGGTCAATTACCTTTGGAA
ACAGCTTGAGCTCCATTGCCGTCGCAGCGACCTCTGCGATCCACTTTTGACACGCTTTCACTTTATTGTTCCTACGTATATGCGAACACAAGCAAGTCAC
ATGCCCGTTATATATGCCATAGCTGGTAGATGGATTCACATGGTTGTTGAGGTAGCCGCACTTACTTTTGAAAGATCGTCACGAGCTTTTGCAGTGGCTC
GAGCTTCTTTTGCGGCTGTTTCCATGCGTCAAAGAGGTCCACGAGGCTCTAAAAGAAGAAGGAGCACCAGCGACAGCCCGCATATTCAGTACACACCCAC
ACAAGCAGAGTACACAAAGAATACAAGCCGCTTCGCGTCCTCACCTTCCACGCGGCCGGCAGGTCCGGCTTGAGGCCCGCAGCGCGACGATACGCTTCCT
CAGAGTCCTCGTACTATAACGCCATGAAGACACACACATATACGCATAGGTTGAGTATCAGCAACGCCCCCGCATCACGAGAGGTACGAAGGAGATGGAA
TACCGCACGCACGTTCTGGAGCTGGAAGTTGGCCATGCCGACACACATGAAGGCCTGGAAGTTGTTGGGGTCGAACTGCGTGACGCGGCGGCTGGCGTCA
AGCGCGTCCTGGAACTTGTCCGCCTTGAGGAACGCGCCCGCGTCCTCCAGCATTTGCCGCAGCATACTCGCCGACAT