Description :
From Genome Similarity Track
Location :
Scaffold_169:25810- 28103
Sequence
2293 bases(100 bases per row)
GTCGTTCATGCTGAACGGATGTGTGTACACCCCGGATCGAGTGATGCAAGGCCATGTGGACAGTGCCCTCTACGTGCAATCAACGAACGAGGAGTGCTAC
AAAGACCTGCTCTACAAGAACATGCTGATCTGGATCGACGACATCTTTGTGTACGCCGACACAGTGGAAGAGTATGTGGATGCCCTCGAGTCGTTCTTCG
ATCGAGTGGCCCAGTACGGGTTCAAGCTGAGTCCGTCCAAGACCAAGCTGTTCACGGACCAAGTCAAGTGGTGCGGACGCATCATCAGTGGTGATGGCGT
CATGCAAGACCCTGAACGCATAGAACATCTGTGTGCGATCCCCTACCCTACGAATGCGGGAGAATTGCAGCTGTTTGTGTGCACCGTGAACTGGCTGCGG
GACTCGATGACAGAGTACGCACAGACCGTCGACCCACTGCAGCAGTGTATGACGAAGGCCCTCGAAGGCAAGGGCAAGAAGAAGCGGATCGCGTCTGGTG
TTCAGTTGGAACTGACCGACGGCGAGAAGCTAGCGTTTGACGCCGTGAAGTCCAAGCTACGATCATCGGTGGAACTGTCTCACCCGCGTGATGACGCCAC
GATGTGTTTGTTTACGGATGCGAGCGATCATGGATGGTCGATTGTGGTAACTCAAGTGGTGGCATTCGATGATGACAGCCCAGTCCAAGAACAACGTCAC
GAACTGCTCTTGTGTCAGTCGGGGATGTTTGCCGGCGCCCAGAAGGCGTGGTCAGTCATCGAAAAGGAGGCCTACCCTATTGCGCGTGCGTACGAGAAGC
TCAATTACATGCTTATGCGACCTACGGGGTTCAAGATGTACTGTGACCACAAGGATCTCATCCATGTCTTTGCCCCGGGCGAAGAATGGAAGGCGCACAC
ACGCAGCAAACTCATGCGATGGGCTGCCATTATTGGCGGCTATCGTTATGAAATCATACACATCGACGACATCCACAACCTTTGGGCGGATATGATGAGC
CGTTGGGGTCAACCGACACCAAGTCTGGCGACCAAGCGGGTCAAAATACGTCGGGGACATGGCTGGTCAAAGAAAGTCAAAGCGCGCAAAGTCCCTCCAC
CGGAACAACCAAAACTGCGACCGCTGGACAAGGACTTTGTGTGGCCATGTGTGGTGGACATCCGTCACGCCCAAGACCAGCATGGCAAAGACAAACCAAG
CGAGCTACCGTGGTGGACGGACTATGGCAAGTGGACGAGCGGCTATGGATACCGAGTGCGGCGAATGACCTGATCCAACGGATCATGGTCGTTGCCCACT
GCGGCAGCGCCCGGCACCGTGGACATGCAGCGCTGGTGGCTGCTATCCGCCGCCTGTTCTATGTCGACCACTTGGCCGACAGGGCCAGTGAATTCCTCCG
TGGCTGCTTGTTGTGCCCTCATGTAAAAGGGGGAAGGGTGGTCCATCGACCGTATGCTCCGAGATGGCACGCGAAAGAACGCAACGAAGGAATCCACTTC
GACTACCTCTACATGGGCGAAGCGTTCAGCGGCGCTAAGTATGTGCTGGTACTCAAAGACGACCTTACCCACTACTGCGAACTCATTGCATGCGATGCCC
CCACGAGCCAAGTATGTGTGGATGCCCTGATGGACTGGATTAAGCGGTTCGGAATGCCACGAGTCTGGGTCAGCGACCAAGGAACCCATTTCAAAAACGT
GGCCATGAAGGCGTTAGCTCACAAGTTCAAGGTCCATCATGACCTAACCTTGGCCTACTGCCCCTGGCGCAATGGAACGGTGGAGCAAATGAACCGCGAC
ATCCTTCAAGTGATGCGGGTCATGCTGCGAGAGTACCAGCTAGCCGAACAGGAATGGGACTACCTATTGCCGGTGGTCCAAGTCAACCTCAACCAAACAC
CGGCAGCATCACTGGCTAGCAAGTCGCCGATGGAGCTGTTCACGGCTTTGAACCCGGCGACTCCCCTGGATGTCGTCGCGGTGGGCATGAACAAGGAACT
CCGAGAGAGCGACTGGATGGTCAAGGACATCCCAAAAAACTTGGACAAGCTGCGTGCTAGCCTGCAAGTCATGCACAAAGAAGTCCTAGACAAGAATGCG
ATGCGCGCGGCGAAAGCGACGAAAGCGACCGAGAAATACGAACAGTGCAACGTCAGCGAAGGCGACTATGTACTCTGGTCTCGCGTCGACAAACGCTATC
ACCCCAAGCTGCTCGTAACCTGGACATGCCCCTACCGAGTCAAGGAAGTGGGCGAATTCTCCGTCGTTTTGGAGCACTTGGTGACCCACGACC