Description :
From Genome Similarity Track
Location :
Scaffold_649:2581- 5280
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_649-snap-gene-0.6Ribonuclease H
Pytap_DAOMBR444maker-pag1_scaffold_649-snap-gene-0.12Gene of unknown function

Sequence
2699 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAAAATATTTAGTGTGGAGTTCACAATAAGGTAAACTT
GTTGAAGCACTCAACCGAAGTGCACGAGCGTCACTTGAACCGTATAAGTCAGCCACAAGATGAGCTTCGATTGCACAATATGCCACTGTGTGCTCAGCAC
AAATGTAAGCTGCACAAGAGGTCGGAATCGTACTCGTCGCCGTAGCATCCAATCCAGCACAAGAGaGGAAAGCTGCGTAAATCATCGTCCCTTGCACTAC
TTCCCATATCGATTCGTCTGTCATCCAACGCAGTTGCGGATAGTACACTTTATTCGGTAGATGCGTAACGGCGATGAGGTAAAAGCCTAGGTGCACATTT
CGCAATCTAAGGACGCGAGTTTAATCAAGGCTACAGTGCGCGGATTGGAAAAACTGGAGCATCGGCTCACCAAGCAACTCAGCTGCCAACCCCATATCAG
TCATACTCTTCAGTCGATGTCGCCGACCCGCCTGACCAAGAAGCCGTGGGGAGTGTCCTCGCACCAACATGCTCTGCGGTACAGACTTACGCTGGGGGCA
CTGAACGTCCGTGATCTACAAGGGCACCGTATGACTTGTCCATACGCCTTCTGTGAGACAGACGACCAATTCTGTGATGTGGACATGCACGGCCGCGCAA
CGATTCTGGCAAACTCTCCTAGCGCGCTGGACAGGCCCAACGTCGCAGCTTGACCCCGCGGCGGTCATCCAGCACGTCTTTGCGCCGTCCGCACCACCAT
TAGCTCCGAGCACTCGTAACGAACTCCTCGGCCACGACGACAGAGTATGGCATCTCCACAAGTCAGTTCAAGCGGTGTGGATGGTTATCAGCTACGCGGC
TACTCAACAACTGTGGCTGACGCGAAACGCCGCCACGTTCAACAACCAGACCGTTACTCTCTGCGAGCACACTGCCACAATGCTTGCCACCGTTCGCAAC
CAACTCGCGGCACTGGCAACaGCATGCAAGTTTAAAACCACAGATGTACCGCGAGCACCGGTGATTAATGCTCTCCTGTCTCGGCTTGCCAGCTCGCCTC
TCGACGAGCCAGAATATGTGAGGGACGTCAGACTGTACTTTGACGGAGGCTCACGGGgCAACCCGGGCGTCACCGGCACCGGCTGCGTCCTCTtGGAACA
CGACAGGGACAGCACGTGGACGATCATGCGGCACGATGCGCACTATCTGGGAGACAAGGAGACGAGCAACGTGGCCGAACATACCGCGTTATTCCGAGGA
CTAGCCGAAGCAGTCCGCCTCTACGAAGGCACAACACATCACGTTACGATCATTGACGACAGCCAACTTGTTCTAGCGCAGATGCGAGGCGAAGCACGGG
CGACCCAACATGGCATCAAAGCGTTGTTGATGAGATCGACGGCGCTCCTGCGCCGATTGCCAGCATATGATCTTCAGCACACCCTGCGCAACGGCAACAA
GATGACCGACGGCTAGCGAATTGGGCGATGGACACACACGGCTCAAGTAGCCTGACCCCAGCAGACCATGAACTCATGACCGACCTAACCGACGCAATCT
CCAACGATGTTGAATCACCATGGACTAGGACTGCCCATCCCAACCGCCTTCTACCCAAAATTCGAGCGAAGCTCCAGGCCAAGCACACGCGCCACTCCAC
CGACAAACGTCGAAGGCACCGGATACGTTAGTTAGCGTTCATTAGCGTTCATTGAGCGGATAGACGTAGGCGACGGCGACAGCGCCGAGGCATAATAGGT
CAATCCTACTCATTAAAAAAAaGAaGAGTTTAATCAATTCAAGAGGGGAAAACGTACTGTAGATGATCGGGATGATAACCTCGACATACTCAACTAGCAT
GAGAAACTCTGTTAAATGCAGCAGAGTAAGCACTCGATCCACGTATAGCAGTTTTCCtGTCAGTTCCATGGAGGCAAGTTGTTCGGCTTCGACTTCAGAT
AATGTCAAAGGTaGCTGTACTTCCTTCAGCACAGGGGCCACGCGGAAAGTCTTCAGTGGGAACAAGAACGAAGAAGGTGTCGAAGTGAGCGTAGTAGTTA
TCACCACTGAAGACAATTTGTCGACGCCGGTGTTCGCTTTCGATTTCATTATAGTCACGGTAGAGTTCGCCAACGAAGAACTGCGATTTTGGCATTCAGA
AACAAACGCCCTAAAAACATCAGCGTCTTTGAGGAGGAACAATACACTGTCAACCAATCGCGGGATCTCTCCAGGAGAGGCTTTAGTGGTGTTCGGAGAG
ACTACCATACTTGCCAGTACCTCCAATTGCATATCCACATCACGAAGAGACACGGCGACGCGAAGCAAATCCATGAGAATAATCACAATTGTTGTGGACT
TGGATCTAGCGTTTACATGCAGCATACAACAAACAGAGCGTGGCACACTTCGACATTGAAAATGATGAACTCGGGTTTTAGATCTTCAAAATACCGCATG
ATTCGTCCAAGCCCAAACTTCTTCACTCCCTTCACAAGAGGAAGCATCACTGCGAACAGCGTTTTGCGAGATGGAACCGAATTTCGTGAACCCGAAGGT