Description :
From Genome Similarity Track
Location :
Scaffold_412:25804- 28179
Transcript NameFunction/comments
Phypl_g8028hypothetical protein PHYSODRAFT_258303

Sequence
2375 bases(100 bases per row)
GTGCCGGGCGTGTGCCACGTGGGGACTGCAGTTGAATTGACATGAATGGTGCGATCTGATTCGACGATCATTTGGGATCGCAGGTTGTGATTGGATggct
ggcttcaacttgcatGGCATGCGGTGATTTGCATGGTACAATCGCGAGACCAACGTCCACGCCACAGTCCATACAAACGTCAAGTATAATTCGACCCTTT
CCGTCCCATATAGCCTTTCTGTCTCATCTCTCAGATTAAGTACGAATATGTAGGAGATGTGGTGCGATTAGGAGAAAGCTGGTAGGCTAGGAGTTCTAAC
TCACATGTCAATGGAGCTCACTTTTGGATTTCATTCCTTCTGAACACTTCACTACAAGCCTCGCCCGCATACTCGTAATTATATGGATGTGTTGAAAGCT
GCTACGACCCTGCAGCATAAGGGCATTACTGTAGTGGATTCCAGGTTTCAGCTTGGTGTTACTACATCGAGAAGCAAATCGATCACTCGAATGTGCCAAT
AGGTACAAAGCTGGTGGCAATGAGTGATCTACTAGAATGGCAACTGCGACCCTGAGTGTCCGACGGTGTCAGCCGAAAGCAACAGGTGACGCAGGTTCGT
GGCTGGTTGGAATGCAGTGTCCAACGGAGCTGCATGAGGATTTAGTATGCTGCACTAACTTTGTATACCGTGTTCACTACTTCTAGCATGGCAACTGCCT
TCTAGAAAGTGGCTTCATATCTGCTTGGCCAGAGTGGGAACGGGCTGGTTAGCACCAGACCCATGATCTCACTTTCACTTTCAATCTTTCCGAGTACCCA
ACAAGCAATACACTCAGCTACTACTTTCGTGCGGGTTGGCCCCCGCATCGCCGTGTGTTTCTGTTGTGTACTTTTGACCCGGGATTACTCCGGCGAAGCG
AGAGGCCATTCAAGCGTCCTTCCTGCTTTTCAAACAGGACCGTAACGCACTGTAGTTAATACCGCCCAAATGATAGGACATTGCAGTTGTTTGCCGCACT
AGCTGCCCGCTGTTGTGAATACAGTGTGCATCCACCTCTTTTCATTATTTCTGATACGAGTAATAGTAGACtgtactactactactactactactactac
tactactactactactactactacgaagaagaagaagaagaagaagaagaagaagaaataaGTAATTTTGGCATATCGTTAAGTATTCTTGGAATGCAAA
CAAacttaaaaaaaaaaaatacgAGTAGCATTCTACCGCAAGTGGCTATCGATTACACGTGTACATGACCTGAGTTGATTTGGGCATGTGACCTCCTTCA
attactacatgtagactGGAGGTCTGCTATCGCCGGAATCCTTCTTAGATAGTATTCATGCAGCGTTATGCGCGTGTTACAAGATCCCGTTAAatggacg
aagctgctcgcctcTACGATGCACCATACACGTAGAGCTTGTGCTTTGAGCATGGTGGCAAACCGTGCTCGCAGGTTGCGTCAGATGTGTATTAATAGCC
ATGGAGGGAAGGAAGATAGATCGTTGTGACGCTTCTGCCGCACTTCCAGTTGAAAATGGATACGTGTACATTCAGGCTGCGTGTGATGAGTGAGAACTAA
AATGTAAATGGTCGGCGCAAGCAGAGACGAGATCAAATGTACAATTCCGCCGAATTATTGATGGAAGATGTTTGGATTTTTACTTTCTCGCAGTAATCTC
CGATTCAAATTTGCCGTTTGCGAACGATGTCTTCATTCCAACCAAAAAAAAGTGCTGCTCCTCAAAAGAAATCGCCGTTTCATCGCGCGAGAGGCAGATA
TCGTGTCCGTGTGTAAGGCCCTTGCCACCTTTGAGGCCTCCATCGACACGCCCTGTGCGAGAATTTTCGTACTTCGCCATGAGCACAACAGAGAGTGTGA
TGCAGCATCACACTCTCACTCATGCTGAGCTGATTTTTTGTAGCTAGGGAATGATCACCCCACTGCACCGCCGTGCTCGACACAAACACCCCTTCAGGGC
CGGTTTGGAGCAGCGTTTAGAACTCGTTCCGCCTCTCAACGTGGGCTTTGCTACACTCTGGcgcggagcagcacgtgTGCGGTGCTCTTCGTTTTGTCGC
TTGCTTAGTGCATTCTGGGTGTGCGCCATGAACAGCTTGAGATGATATCACGCTCTCATTCGATGTGATCCACAAAATTGAGTTACAAAATAATGACCCA
TGCTACCAGTAGGTATTTAGGTACCATAAGGAGTACCCGCACTTTCCGAATTTCCTAGAAGTATCTGCCAGCCTCGGGCAGCGTTTCCAGCCAGCGCAAG
ACATGAAAATGGTTGCGTTCACGCGCTTCGTCAATAACAGCCTCAAACCCAAAATGTCTCCGGTCGTGGTCGTag