Description :
From Genome Similarity Track
Location :
Scaffold_2:258- 5250
Transcript NameFunction/comments
g1288.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g1289.t1hypothetical protein

Sequence
4992 bases(100 bases per row)
CCGTTGGCTTGTCGAGGTCGACACTGCCATAGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCA
AGGAGTTGGGCGTACGGACGCCGACTCACGGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAGGGAGGAACTCAGACTAGCGTTTGAGCCCCCGCAAA
ACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGT
GACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCGAATACT
CTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGATAAACTGCATGTGAACGCCCCGCGGCTAATGCCACGACCGGTGGTAA
GGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGTATCAACGAATGTGCGTTGTTTCCGCTGCGG
AAACATCGGTCACTACGCTCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTTACGGGCAATAAAAAAACTAA
GGGACCAGCAGGCACGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCT
CACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGA
ACAACTTTGTTCGACTGTAGATCCTTTCAAGGCTTGACTTCGAGGATGTGAAAACACCTCGAAGTCTATTGAAGTGAGGCTAGAAACGGGTGTCGTTGTT
AGGACCGAGAAGCGTATCGTACGAGTACGCTTCTCATATCAAGAGAAGGAGTTCGTCGACAAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGG
TATTGGGCATGCCGTGGCTTGCACGGCATGAGCCGGTGATCGACTGGACGAAGCGCACGATCGTGCACTTCGGGAGCAGCAGCAGTGCGGCAGAGAGCGA
TGGCGCTGTCGGCGCAGCACATGCACCACGTGGTGCATGAGGCCCTCCACCAGAAACAGCGCGGGATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCA
ACGACTGCAAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGCCTGATTCAATCGGATTCGAGAGGATCTCGAAGCGTCCGGGGCGACGCGGTCG
TGTCGACAGATAATGTCGACACACAATTTGTCGAAAGACAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCCCAGAGCCGACGCTGCAAGTGGTGCGGGAC
GGTTGCAACCGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGTCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAAC
AACTGTCCACGGCCGGGCCTGGACAACAAGAAACTCGCGGAGCCGGGCCCCGCACGAGAAGTGAACGGCGCAAGCGAACAGAGCTGCGCAAGTCTCGGTC
AGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTC
CAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACG
ATGGACGCATCGGGGAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCACCTCATGTCTGAGGGCGCGGACGCCCT
CAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTC
CCGGACGACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCAC
TGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTT
CTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGAT
GTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCA
CGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTT
GTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCACACAGAG
CATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGTACAAGCTTTACGCGAACCTGAAGAAGTGCATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTC
TCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGTCTACGCCTTCAAACCTAAAGGAACTGCGGCAGTTCCTTGG
ACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCT
GATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATG
CATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGAGATCGTGTGGTTTACTACCAATCGCGTCATCTGAAGCCAGCTGAGCG
CAATTACCCGGTACATGACAAAGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACGTGGGAGTAGACCATTCGTGGTCTACACC
GACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGACTGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGT
ACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCCGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGACGTCGTCAGGAC
GACTACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCAGTTGTTGGAGTACTGCTCCACACCTTCTGAC
AAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGCGTACACCGTTATCGTGTACACAATAGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAG
ATCGCATTGTCGTACCGGATGATCATGAGTTGAAGCTCAAGACCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGATATA
CTTGCTTCTCACGCGTGACTTCTACTGGAGTCACAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCA
ACTCGCAGGCCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGG
ACTGGTATAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGTAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTTG
ACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGG
GACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCAC
TCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCA
TGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGA
TACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGAGCGTAGACACTTTAAACAAC
AACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAG
CCGTAATTCGGTTTGTCCAGGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGAGGAAACACAAATGAATTCAAAGT
TGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACC
GTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGATTGAAGCCGTA