Description :
From Genome Similarity Track
Location :
Scaffold_48:258- 3060
Sequence
2802 bases(100 bases per row)
CTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCGATCTCTCCAGCCTTGAG
GTTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTTCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAA
CCCGTCTCGCTATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAA
CGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGA
CATCCGAAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGT
GGCACTATGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACTCACACAGGAAAGCG
TATCCGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAG
CTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTGCCCACTTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTCGGAGTCGTC
ATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCAGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACC
AATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCA
TATCATATGGATCCATATCGAGAACAGTGAACTGTTTGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGAC
CTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTATCGCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGT
GCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGGTGATCGTACCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCG
CCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCC
CGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTT
CCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTT
GGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGA
ATCGCCTCTTCAAGGGTGCTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCAAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCAT
TGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGTCTTCCTTGTTTACACGCGAGGAAGCGCGAACG
CTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTGGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGTG
TACACCCAACTCTTAGCACGACCGCTAAGGTTGCAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTT
CTCGGACCAGAAGTGAAGGTCTCGCCTCATCCCATCATACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGACGGGTTTGCTTCCGCCGCCGGAGCC
TGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCT
GCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTT
CGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTT
CCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTAT
ATTTATAGGTAGGTTAAGTTTGTGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTAC
CTTGTACCAAATATTCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTA
CA