Description :
From Genome Similarity Track
Location :
scaffold_54:258- 20711
Transcript NameFunction/comments
Pl_110978hypothetical protein PHYSODRAFT_504989
Pl_110979hypothetical protein PHYSODRAFT_315943
Pl_110980hypothetical protein PHYSODRAFT_315967
Pl_110981hypothetical protein PHYSODRAFT_507552
Pl_110982hypothetical protein PHYSODRAFT_302198
Pl_110983ubiquitin-conjugating enzyme E2, putative
Pl_110984hypothetical protein PHYSODRAFT_506933
Pl_110985hypothetical protein PHYSODRAFT_561505
Pl_110986hypothetical protein PHYSODRAFT_510279

Sequence
20453 bases(100 bases per row)
TTTTGGGCTCAGCCATCGTCCATGCACTTCTGAAGATCACTTCCTGACAAAGTGTGAAACGCAAATTGGCTGGCGGGCACACGTCGCGACAACACGGACG
TGGGGCGAATTCTTGAGAGCAGCGACTAGCACTTTGCGAGTGGCCGCGCAGCCCAAATCGTCGGTGGCACCTTGCTGTGCGGGATCTGCCTGCTACAGAC
CCAAACCATCCTGTCAGTCGCAGCCTCACAGCGCTAAATTGCTAGCCCTGCACTTGCCTCGAACGAGTGCCAGTTCGGCATGTCACAGCCACTTTCGGAG
ACTGTTGATTTGCAACACTGCCAGGTTGATGGCATGCTGCAGGCACCGCCGAGATCGTCGGACTCGTTGACGAGCCCCTTTAACGGCTCCTCCTTTTCGC
GTCGTCGGTCCCCGATGGCCCTGATGCGAAATATGAAATGGTCACTGTCGAAGGCACGTCTACTGATACATGTAGCATTGTCGGCATCGCCGATCAAGAA
ATAACGCATATGTAGCTAAAAATCTTGCACGTACTGCAGGCGGCTGCCTGGCAACCAACCCAACCGGCTGTCTCCAGTCTCAAGCGATATCAGATTGCGC
CGCTGCCGGTATCGTGCGCGAAGATCGACTCATTGTCAAAAGGAGCGCTACGGCTTCAATGAGGCTTGTCAAACATGTTTCAACTGTATCCGCGGCATTG
TACGGCATCCAAACAAGGCGCTGTTGTTACATGCATCATCGCTTGGTCTCCGGTGATCTTGATGTCGGTAGAGAGTCGGTAGAGAGAGAAATTGCGCAAT
CAGACGAAGAATCACCTACCTACATGTCGCTACCTACATGCACTCCCGCAGCAACTGCATTCCGCCCCAGTCTTGGCTGGAGTGCTGGTGCCCAAGAGAA
CCTCCCTCTGTGTGACATGGTATTTCCTTCCTTCTCTCTGGATGGTCTGCCACCGCTTAAAACGAACGCTTATTATACATGCCGGTCTAACATTTGTAAC
GAAATACAGATTTCTTTTAAGCCTCACATTGTCATCACAACCTGTGCTGTTTCTAACGTTCCGAAAGAAACCTGGAAATGGCGCCGAGGCGGCATTTTCG
CCAGCAGATCCATCAGTTTGGAGCACTACGGTCTCGGCATCGTGTCCGCCGCTAGTCTTTGTGTCCGATTGACGAACAATACTTTGCGCCAGTAAAAAGT
ATTCCACGCGGCACTACTCTAGGATAAATACGTTCATTTTTGAGGGCATGTCAACTGCAGGTAATAATCGACTCGATTATTGAGTTCATCGTAGATACCG
AATCGTGTTTGCCAGTGGACAGACTACAGCTCCCACCCAAGCTAACCACTCCACTGGACGAGTCTTTGCTAGTACTGTGGTTGAGAGTGTACCAAACGTC
GATGTACTAGATAAAAAGCCTGGTAAATAGATAAACTTTCTCTCTCATTCTATAAAGACTTGTGCCGCTACATGTTCACTGAAGACTGAAAAGCGAGATC
TGGTTCTCCTCAGCAATAAAATAGAGCATCCAGTTTCATCAGTTCAGACATATCGCCTTCAGCACGGTCTCCGTTAGCGACGGTCGGTGGGATCGATGCC
CGCTGCACGGTGCTGTCTACGTGTGCAGCGCGGAATGGAGTTGTACGAAGTTCGTGCCCTCAGTTCCCTTGAGACACGCCTAGCAATCATTTTGATTACC
ATTGCGTATCAACGAATGACGCAGAACAGAATTTCCGAAATTTGGAAAACTCTTCGGTCTCACTTAGGTACGACAATTAGCAAATACTTAAGATGTTTAA
CTAACCTGACCAGAAGTCAGCCCGTGCTCTTGCCTTTGGCAAGTTCCCAAGACTTGCTGACAACGGACGACGCGATGGAGATGGAAGTGCATTAGTGTAG
TGCTCAAAGATACTGTCGAGAAAGCAATCCTTGGTAGTGCAAAGTATCAAAGGAGATGATACTCTATATCATTCGACTCGCGCCGACTATCGAGCTTGGG
CATCTGGAACGACCGCAAATACCAACGCGGTGCCACCGCGGTCAGGCTCAATTGCTTGAGCTGCAAAGTGACGATTTCGTACCAAATCAAATGGCGACAC
GGGAGTTGGTACAACGCGAAAAACTCACAGGTGCAGGCGCTGCCATCACGCTGAAGAATTTGCTTTTCACGAGTCGTTTTGTTTAACCAGCGCACCGTCG
CTTCTACAACTGGCAATCGTGATGAAGCTGCTGTATCGCTAGACTCGGACCTGTTATTACCCGATACAGCTTTCGAGGCTCTAGTTTTGGTGATAGTCAC
GGATCCAGAGGCATACGAGCTTTGAAGCTGAGAGCTAATGAGATTCACAGCGAAACTACTGAGACAGTTGACCATTAAATGTAGCAGGAAGTCATAGCGG
TCTGCTGCAACAGGCTTGGTTAACTCAAGGATCAGCATCTTGGCCGCCCACTCACTTTCGACAAACTTGATCATGGCCAGTATCTCAGATGTGCACTTGG
CCAACAAGTTGCCACTATTGCATGTTGCCAAATCCGCGGCGTGAAATGGCATCGGCATTGTGGTGGCCTTGCTGGACATTTTCGATCTACTTTGAGTGTT
AATGTCAACAGACTGGAATGGCATTTTGAGTACTGGTGGCTGGCTGGACACCGTCATTCGACAAAGAGTGCGGCAGGCAGTCGTGCGCACTCCCGCAGGA
GCACTATCTCTCGTACGCTTAAACGCATTCTGCATCGGTTCCCAAAACTGTTTTACACCTTTTGTAAAGAAACAGGATAAATCAAACTGCTCTGTGCGCG
CGTAAGATGTCCAGAGTGTACGGTATGGCTCCCAAACTCTATCAAATTGTGCAAGCAGATCCTTCCTGTCTCCAGCGGCGAGCTGTTGAGCAAGCAAACT
CTTTGCTTCGTTGTATTGTAGTTCGGAATGTGCAAATACGAGCTGTTGGAGTGATCCGATCATGTTGTCTTGTTGGAAGTTTGTGCTGCCAGTTATTCCA
GCTCGATGGTCTCCTGCTTGGATCTGCTGCGAATACACCAGAAACTCGTTGAAACACTGAAGCACGTGGAATTGGCACAGCAACGGCCGTGCTTCTGGAA
ATTCACTCGTCAGCACTGGTAAGGTATCAGGCAGTAACTTGCTCATCGCCAGCACCTTTATTTGTCTCCATTTGTGATGTGTTCGTTTGAAATCTTGACA
CACTCTTCGTAACAACGATGACGACATGGCCTTTGACCGGACCAAGCAAACAGGTTTGGCATTGCCTAATGCGTCCATCGATAAGAAACCATGCAATTGT
TGTCCTGCTTCCACGTCAGTTTGACTCGCCATTGAAATGTCCAATATCACCAGTTCCGGAAAGACTTGGAAGTGTTCTTTCATGGCTCGGCTAGCCAAAC
AAATTGCCTCATTGGAGCCGTCGTCGCCTGACAATATACTCACGTGGTTGTCCACGTCAGTATTCACAAATTGCTGCAAAATAGGCTCCACCCGTGCAGT
GTGTGGGTCATTGTTCAGCGAGTGTACTGCACTCTGTGAATCGCCAATCTCTAGCGAATTTCCAGTAGCCTCTTGTTGTGGTTGGGATGGTGCTGTAGCC
TCATGTGAGTTCTTCTCACGCTTCTTCAATCTTGCGTACAGATTGTGCATATCCTTCATAGTACAGACTTTACCCGTTAATGTTTCAATATGCTCCCGAG
CAGCTCGCTTATTGGAACCAATCCGACGCATGAGCTCAGCTTCATGTGTAAGATATGGGTGTTCAATCACTGCTGCGCGGTTCTGCGAGTACATTCGCCA
TTGCTCCAGAGTCACGGGGTGATCACTGTGACACAAGTGCTGGCTTGTAACTTTGATAAAGAAAACTCCACGTCCATCTTCTGTTAACTCAGTCACCACA
CAAGCCGTAAATCGAGCTTTGCAATCGGTGTAGCGCACATTCTGTCGTGGGCGAGAGCCACTTGACCGCGACATCCGCTTATAACCATGAGTACACACAT
AAATCTGGACAAATACAGACAGAAATGCATTAAAGCAGTGCATCTAGTCCAATGTGGACATTTGGTGGACGCACCTTGCGGTCGTAGATCCAATTATCTG
GTACCTGCAGTTTGCGGCGTTTATTGGCCACTGCCACTTTAACAGTATTGCGACACACGTACATAGTGTATGTTTTCTCGCAGTGAGCTTTCCTCGCTAC
GTCAAAAGCTTCCCATGACGAGTAGCGTCCCTCAAACGGTATCACGTCGAATACTGTAGACGACATGGTACTGGTCCGGAAGCTATTCGTCCACTGAAAG
CCTGTTCGACCAGTACGAAAGGCGTCACTTCACAGTGAAGTAACGCATGTTTTCAGCCAATCACGTGACCTGAGCTTTTCAATTTTGAAGGCATGAGCAT
CCATGTGCACGTGGGGCAGTGTGGCAACCAATTGGGTGCTGCATACTGGCGTTTGGCCGCTGTTTCCGGCGATACTCAAGACGACAAACGTAGTCGAAAT
ATCTCCGGTGTATCTCGAGAGCTTTGTCGCGCGTCTGGAGACTCCACAGCTGCTGTAAATGACCCCCAAAAGCCAATATCACTGTCGAGACATTTGTTCC
ATCCATCGACTCGAAAAGCTCGCTGTATTCTCGCGGATTCGGAGCCTAAAGTAGTTCGTTCTATATGCGAAGGTGGTGGTAATAGTTATGGTGCTTTTCA
ACCGGCTCATACACATGTGGAGCAAGCTGGACGAGGCAACAATTGGGCCATGGGATACTATGGACCGAGACTGAAAGCTCCACCGCCGGTTTTCACGTCT
TTGGCTGTAGATGACCGCAGAGGATTGGTAGAGCTGGTAATGGACTCATTACGACGTGAGGTTGAGAGTGTAGACTGCTATCAAGGCAGTGTGGTGATGC
ACTCGCTGGGTGGAGGAACAGGATCGGGATTGGGCTGCCGAGTGCTGGAAAACATACGCGACACGTATCCGAAAGCCTACATTGTGACTGCATCTGTAGC
ACCATCTTGGACACGTGGAGATACACCACTTCAGAATTATAATGCAGTGTTGACGTTGCAGTGTCTGCAGGACGTTGCAGATGCCATTATTTACAAAGAC
AATGATGAGTTATTGCGAACGGCGGGTTACTGGAAAGCTTTAGTGCAGGAGAGAGCAGGGACTGACAGTATGAATCAGCGCATATCGCTTGAGGAGATGA
ACTGCATGGCAGCAGCAAATTTAGCAGGACTGTTGTTTCCAATTGCTTCAGAAACTGGCATTACTCGCTCGTTCGATTTTGGTAAGCTTCTACATGATGT
ATGCCCCATGCCTGCGATCAAGATGCTTGACGTTCGGTCGGGCGTATGGAGAGATCGTATTGGATCTGGAGTGCACACTAAACTTCCGTCTAAGGCGTCG
GGAGCAAAAGGTGTGCCATCAGCGAACTTGTTTCACGCCCCAACCGTAGCTCAAGTACGTGCGCTGTCGCTTCGACATCAGCATGCTGTTGACTTTGTCG
AGTCTCTAGACACACTTGGAAAGCTTGTGCAGCAGGTGGCAGGTTCATTTCCACGCAATCCGTATGCGGCCATGGCATCCAGTACAGTTGTTCGTGGCTT
TAGTCCTTCCTCAAGCGAAACTGGTCGCTTTTCCGATAAACTTGGTGGGATCGTCCAGAGTGCTTTTCCTCCTGTGCCATGGTTAGCAACAACATCACAA
GCCCCACTAACTTACTCTAGACCTGCACCATTTTCATCTTTGCAAGCAAAAGCTTCAGCAACGATATGTGTGAATAATGGTCATTTCCTGACGAGCACGA
AGCGCTACTTAGAACGTGCTCAGCGCCAATTTCACGCCAGTGCCTACGTTCATTGGTACAAACAGCACGGCATGGAGGATGCTGATTTTAAGAGTGCTTT
CGACAAATGCGACACACTCATAAGCGAATACGAAAGTTTGCTACGATAACTTGCACCAGCACCTGCAGGTATTATCTCTGCAAAGCAGACCTCAATTTCT
GAATTTCTTGTGCTACAGAACGAATACGGCCCTTCGTATGAAGCCATTGCTTCGTATGAGCTGCGTGCTGCTCCTCCATTGCTCGAAGCTTCGACAGAAG
TCGTGGATTAGAATCAGCATCTTTACGCAATGCCTCCAACTGCTGCTGAGAAGCCTTCCACTCACTTTTTCGTTGGCTCAGTGCTTGTAGTTGCCGTTCT
AAGACGTCTAACTGTCTTGATGTTGTGTTTGGCAGAATAAGGTCTCTACCTTCCCTAGGTGGTACCACTGAGGTAGTTGTAGACAACTCCGGACGCTTAC
GACGTTCTTGGACAGCCATCGTGGTGTTAAGTGGTGACTGCCAGGGAGAACGGGGTGGCTTGACCTTGGTGTCTGGCGGGGGGCGTAATGGAGCAAAATG
TTCAGCTGGAAAGTTAAAACCACAATGTAAGGCTTCGTGTGTACTCGAGTGCTCGTTGGATAGTGGGAACGCTTCAGCTTCAACTTGTGAGAACAACAGA
GCCTCAACGGGTCTTCGAGGCTGTGGTCGGTTCCTCGGAAGCAACACGAACTCTGACAGGGGAGATCGTTTTTTCGTCCAATTTGTGTCTTTTGCATCGA
TCGCTTGTCTTAAGTTTACTGCTGGAGGATCTGGAGGTTGCGCATGTTGTGCGTCTCCTTGGGATTGATGCTCAGGTGGCCAATACACATCTTCTGGAGT
TCGTCGTGGTACATCCCTTGGTTTTTCTAAAGTTTGTTTTTCTCCGTTGATAGCTCGGCGCTTAAGCACAAGGTATTTCCAATGGCGGGCAATAGCTGCT
ACCCTTCGCCAAACGTTCCTCGTATGACGTGCTTGAGTGAGATCCACAAGCTGTTCGCGCTGCTCTTGCAAATGTAACGCAGCTGTCATCCAATGGCGCA
AACCATCACGCACAAACTGTTCGTGGCGATACTCAAGGGCTTCGTGGATGCGTAGTTGTTTCATTCTCTTTGCGTACAAGTATTGTTTCCACCCGTCAAA
CGTTTTGCGTTCCAATGTCAGCTTCCAATGTACCAGAGAAGCACGTATCTTTTTGCGATAATGCTGACGCTGGATTAGGTTGTTTCTCCATCGCTTGAAG
CATTTTCTCCAGATCACGCTTTTGTAATGTTGATCTGCTCGTATGCAAATAATTTGCTGCCATCGCAATATCGAAACATGCGTAACCCATTGAGATAAGT
ACTTTTGTACAGTACGTCGTTGTGCTTGACCCCGAACTTGGGCGATTACAATCCTTCTGGTAGCTTTTGCGCGGGCATATTCGAACCAATTTTCAAACAC
ACAGCCTTTTACACCTTGGTTCTTCCTCATCAAGAAGTTTTGAAGCATTTTATCTAAGGAATATTTTCGATTGCACTCAGCTCGCCACGCATCTTTCCAC
ACCAAAAAGCTCCGTCTGATAATTTGCTCGTAGTGGTGCACTTGAGCAGCCAACATCATCTTTTTCTTTGCCAGTGCTTTAGAAACGAAACACCGAAATC
CTTTTGACCAAATTCGTCTTAATAATCGCGATTCATAACGAAGGAAAGCACGCTCGCACTTCAGCGTTCCCAATTTCCTTTCACTAGTGAAAGAATACCA
GCGTGAGAATACAGACGACATTACCCTCGCATCTGCTGCGTCCAGCATGTTCTCCACCCGATTTAGTGTAAGTTGCTGATGAGTACGCCAAGTTTGAAGC
CTGGTGAACCCCTTACGTAAAAGTGATAAATAGTAAGCGCGGACAGCACGACGCCGTTGCTGTTCTCGGTGCTCTTTTTCTCGTGTCCACACACTCCAAG
CTGTCCACACCCGTCGTAGCTTCCTTTCCTGATAACCTCGCTCAAAGGTATCAAGTTGGACAAGCTGACGGATCTGAGTCTTCCACGCACGCCACGCTCT
TTCACATACTTTTGTGTACAATTGACGGTCAACTACACGAACCAGCATGTGCTGTGCTCGGTGCCGCGTGTACTCTTTTTCCCATGCATCAAAAGCAAAC
TGGAGAAGACGACAGTGGTTATTACGCGTCACAGCATCTGCCATCGATCGGTACAGTAGAGCTTGATGCCGTCGCCGCCGCGCGTAGCTACGCCACATAG
TTAGAGTTTGATGTAATCGTAGTCGTAGCCGCCACAACTGCATTGTCTTAACAAGCAAACGCTGCCGATTTGCTGTCACAATTTTTATCGTCAGCGTGCG
TTCTCTCTTCTTTAACAACGCATGTCGCCCAAATTGATTCAACGACCGCTTGAGTAAACAATAGTACAAAAAGAAATAAGCTCGCTGCTGTAGAACATCT
CGTTTCTTTTTCATCCGCACAAACCCTTGCCAGCGTCGAATGGCATGTGACGAACGAATGCGCACAACTGCAGCTACTTTGTGCTCATCACCGTCAAGTC
TTCTCATAACCCCAAGGCTCCACCGCTTTGTAGCAAACAAGACACATTTAGTCATCACCAACCAAACTACTAGCAAAAACTCTCAATCAGATCTTTCACC
TTAAGGTGTCTTTTTCTCAGCAAAATTGCAGCATCCAGTTCAGCATCTTCTCCTTTAGTAGAAGAAGACTCTACTTCATCCTCCTCGTCAGTAACATTGA
CATGTTGAGTGCTATTATTCGTTTCTTCCTCTCTTCTTAGCTCTTCATCTGATAATGCCGCTGCATTCTGCTGCTCTCCATGTTTATAAACAATATACGC
TCGCCATTTCTCCCAGAATATCCGTTGGTAGAACGTAGCACCTACTCGACAAGCAGCCGCAACTCGCTAATTATAATAGAGACGTCACCATTGAATTAAC
ATGAGGAATCTGATCAAAACGACATCAATCTTCGTACTTTTCTCCGTACACGCTGCATCTGAGCACGTCGCTTCCACGCCAGGAATACACGCAAAAGCAG
TGCGTATCGGTCATGATGCACAGCCAGCAGCATCTGGGAGGGTGGAGGTGCTGGAGCGTGCAGCAGGTCTCCATGGATGACTCCGCCTAGTTCTGCCATC
TTAGATTGTCACGGTCCACGATTGGCTAAAACTCGTATCGTTACTTCACAGATGTAGCCATGTATCAGGTTCTGTAAACAGGACTTGCTGCATTGGGAAA
CGCATGCAATAATGTGCGAGTCCAGACCCGGCGACTTGCGAACGGCATTAAATTTCCTCTAGACCTTGTCGTTGATGCTAAAACAAGATGAACGTTTCTG
GCTAACAATCAAGTAGAGGTGAGAGCTCGCCTATAAATGGTTTCTCATCAAGTCCTGACCCCTTTTCTCGTGTCCTCAAACACTCAACAGTGCCAGCTTG
AGCGTCACAACAACCGAAGTAATACGAGTTGACCAAGTAGAGAACACTCAACAGTGCCAGCTTAAGCGTCACAACAGCCGAAGTAATACGAGTTGACCAA
GTAGACAATTGATGAGATGCGCGGGGCTACCACAACTGATTCAAGACCGACGAGACCACCGTCGTCGAGACGCCCCAGCGGCCGCTTTCCGATATACGAG
GAAACTGCACAAGAATTTCGAGCAGATTCCTCAAAAACAGCAAGCAAAACAGGGTCTACCTTGAAATCTACCGGTCACCTTTTAATTCACGACGACCTAG
TGCCAGCAGAACCGATCGACTCTCGAGATCTCTCTCCGAGAGCCACGACACCGTTGACAAGCAGGTCACCAACTCGACTCAGCGGACGTCTTCAAACCCA
TGACACTGGGATAGACACCAGCGTAGATGAGCTTTCAGTAATGACGTCCAGAATGAGCAACCCACCACCACTTTCGCCGCAGTACAATGCTCGGTTTCAG
TCTCAAGATCATATCGAGACACTCAAGTCGGAATTACCAATTGGATCTAGCCGACCATCTTCAGCTGCCATGCGAAGTGGGCAACTCCAAGTTCGTGATG
AGATGTCAAGTAACGCAAAAGATATCCCGGCAGTATCGCCACGTAAAAGTCGACCGTCTCAAGAGATGTCTGATAACTCCCGTGTGCAGCGTAATGATAT
TTCCGCCAAACCCGAGCTACCAGCAAGAAATATTCCGCTTTCGCCAATCCGACAGCTAAGCAGTCGTATTAAACTTCATGATGACGGTGCACTTACTAAC
AGACCGGAGATTTTCCCAAAGGCAGTACCAATTCTACCGATTCGGCAATCAAGCGCTCGCCTACAGATACTTGTTGATGGAGCAGTGACAAGTAAGAGGA
ATTCATCCGCTACCAAGCAGATTGAATCCGTAGCAATGGCCATGGATGTGATAGATACCCAGAGCTCTAACCAAAAAGGTGATAAGCAGTCTCCCGACCT
CTCTAAGAGTAATCCTGAGAATGGCTCCGACATTTGTGATATCCAGACGTCACCAGCTGCAGATTTAGCTTCGGACAGCCTCATTTCTCGATTCGTGCCG
CTGCACAGCCAGTGGACGTACGGTCAGCGCGTTTTCGGGAGATACAAGAAGACACCGTACTTTTACTCAGGTAATCTTGCCACTTATCTCGGTTCAGGTA
TGTTTATGATCGTTTTTGACGATGGAACGCTCGACTATCGCACTCGTCGTGAGGATATTATGATACGGGAATCCCCTTTGTCATCTTCCTTATCAAATCA
ACAAACGAAGAACCGACGGGATAGTTCTTCTAAGATGGAGGCAAGTGAATCTCTGCAAGTTAGCAGTTTTAGCGGATTGGAATCGGGAAATACTAATTGG
TCGAGAAGGTCGCAGCAAGAGAACGACGATTATTGCCCAGACCCGTCGGTGGTACCAGAGATGTATCTGCCTCCATCTCAACATGTAATGGTGAACTTCT
CAGTCACACCGCCAAGAGAAATGGTCCTGAGCTTTGACAATAATGGAACTGCTTATGAGGTTGGTCCATATTGTGGTGTCCGAAGTACTGAAGGCGAAAC
TTGGCGGCTTCTTTTAGATGACGAAACTTTGACGATGAAGCGGCTTGAATGTGGTGTTGGCTACGAAGATGACTCAACACAAGTCAGTGACTCAGATGAT
TCGAGCGACGAAGATATGTCAATGACACCATGGCAGCAAATGACACAAACTTTCGGTATGGGCAAAGTTACTCGGGTCCAAAGACGCAGATCGAGTATAT
CATCGGTTTCCCAGATTGATCGGCTTTCGATCACGCAGAAGGGTATGAAGCAAATTATCCCCACACCAAAAAGTCTCAAGCAGATAATCACCGAGTACTT
TTTGCGTGGAAACAAGAAGGTTCAACCTACAAAGCTCACAGATGAGCTTGCTTTGGCCGAACATGTCCGCTTGATGGAGGCAAAACTTAAAACTTTGAAG
TCAACGCGATGCAATTCAGGCTCACCGACAGCATCTCTTGCTCGAGGGACATGTGGTAGCCTTCGAGTGGTATACGAACGAGCCCCTGATGGCATTCGCG
CTTATGGTACAATCACAGAACGAGGCGAAGACGGAAGCTATGCCGTACTAACTGAAGATGAACACGGCATTTCGGTACAAGTTGTGTCCGAAGAGAAGGT
TGACTTCTTACCATCCGTAAATGAGCTGGAACAACAGTTGACAGACCTTGAGCGATCACAACGCGTGCTGTTTGTCGGTCAAAAAGTTCAGGTTTCGTTG
TATCCGGGTAGTCGCTTTTCCGGCCACGGGCGTATTACTCAGGAGCGGCAATATCAATCGCGCTTTAATGTTTTGCTCTCAAACCGCATTCGGTTAGTGG
ATGTTCCTGCGGACAAGATCAGCCCTTTGCCTGAGAAGAAGAAGGCCGCAGTCACTATCACCGAAGATCAGTTTCTCATTTGCAGTAACAAGGTCAAAGT
CTACATTGGTGATCAAATCTACGTCAAGTATTCGTCTGGAAATGGCGACCTCGACACCACAGCTGAGGACGAGAAACTTGGACTTCTGAACGGTATTTAC
TCGAATAAAACTGCTGCTGTGGACTTTGCTGACGGCTCCACTGGCTATGAGATCCCTCCGCATCTTATCTTTAAGAGGAAGCGCCTAAGCGTACCTGCAG
ATCAAGACGTGCGGTCTCTTAAAAATGCTGTCCTCATGCAGGCTTCGGGCGGAAGAAAAGTGCCCGAGGAAGGATACCAAGTAAAGGCTGATCATCCGAG
TAAGGCCACCGTTGAGAGCTGCGTCGTCATTAAGACGCACCCTTCTTCAGCTTGCGACCTACGTTTTTCCGACGGTACCATCGCATTCGAGGTGTTTCCA
TCTCAAATGATCATTGACAGTATGTCTTTCACACCCGTCACAAATGGCCACTACAGTCGAACGCGCCAACCACCAACTTATGCAGTAGGAGATTACGTGC
TCGCCTGGAGTTCACGCTTTGGACGGTATTGCTCTGCCAAAATCATTGCCAAAACGTATCAAGACCCTTCTGACCCTCCAGAAACCTTATCATCCCCGTC
AGTGAATGGTGTTGAAGCGCATGCATCTCCAACGGTACATGCCGTGAGCGTGACTGCGTTTTATACGTTAGTATTTGATTATGGCGAGCAAAAAGCACAA
GTGTCATCCGACAAGATCACTCGCCTGGATGATACTACGGCGTTGTCCCATTCACAGCGGTTAACCAACTACAGCATTGACACAATGGGGTTTGAGTTGT
CAACTGTGAGTTTCGCCGTCGGAGAGATCGTTATGGGTCGTGTCCATGGGTCCGCTCGATATTTCAACGGCATCATTGATGCTGTCAATGAGAAGGAGCG
AATTTGTGCAGTGTGTTTCGACTCGTCCGAGCGCGACGCGGAGGTGCCTTTTTCAGCCATGTTCTCTGTTGACACAAGATCACATTTTACATGTCAAAGC
TCTAGTACGAAGCAAGTAGGCAGTGGTGCTAGCTCGTCTTCGGAAGTTGCATCACGAGGCAGGGGGCTTTCACGCCACCGCGCTACTGAAGACACAGCAG
CAGCATCAGAACCAACCATCCGTCAACGACGACATAGCAATGGATCAGTGGGGACTATGCTTAAGTCTGTGGCTGGGAGCCTTTTCCGAAGCTCACGCTC
AAAGCGCAATCTTGAGTTACGACGAGGGTCACACATGATTACCGAAATTGGTGCTCGTCTTCGGCTTCCTGAACAGTAAAATTTTCTGGTTATTTGTCGC
GATTTTCGCTGCTGAGCAGATATCGAAGTAGATCACTTGCCTGAGAAAGCGAGGTTCTGGCAAGACATAATGTGTAGCATAGTAGTAGCACCTGATCACC
TAAAGACTTACTATTAGAAAATAAACCGACATGCGCTACTTTTCTGTCGTTTTTTGCTGAGCGTGGCTGTCACCTTCATCTCAATAGCTTCACTATATCC
ACAACAAGTAGCCAGACTAAAGTGACGGAACCCAAAATCACGTAGTATTTGATCACTTGGCAGCGAAAACAATACCCATAAGGGCAATGAAGATGAGCAG
TGCGAAGATTGCAATGCAAATCATCTTCATCTTTGAACACCCGCAACACTTCTTGCGTTGTTCCGCTTGCTTGACCTGCTCCAGAGCCTTCTCCACATTG
TCCTTGGCAGTGTCTGTATTGTCCACGATTTCCACCACCATCTCTCCCTGGTCCTGCACCAGCCCGTCGATCTCCTGGAACGCAGCATTCACCTCACGCA
ATTGATGGTTGATCTGGATAATATCATCCTCTCTCCGCTGCATGTCTGTTCATTAAAACACACAAAACACATCAGTCATATTCCTCCATACAAATTGCAA
CAACAACATACCGTCTTCATCGTAGATAACCACATTAGCCTGTGCGTAGATCTGATCTTCGTTGTAGTTGGTGAACTCGGCACCACCGCGCGTCTGGTGG
GCGTCTCCACCCTTGAAGCTCTGCGAGGAGCGGCGAATAAACTCAACTGACTGTCGCTCCGACTCAAGCAGGCGCTCGCACGTCTCCTCAAATACGCGCA
CCTGGTTCTTAAAATCAGCCGAGAGTTTGTTGACTTGCGTGCGTCTCGTACGGCCGCTAGCACCCTTCGCACCTCGGTTGAGCTCCTGTAGCCGACGGTT
GATCTTGGCCACGAGTTTATTACCCTTTTCCGTCAGCTCCTTGATCTGCGTGTGATTGGCGCGTGAGTCCTGCGGTGTTCCGAACAGCGACATCTTCTGT
GCGATGCTGCGCGTGAGCTGGTTGAAGGTCGAGATGCCTTTGCTGGTCTCCGACACGAGCTTGCCGAAGCGCTCGTCCGACATGCCGCCACCGCTGTTGC
GTGGAGACTGTGCGCTACGATACCGGTCGCCCATGGCTGATGTAGATGCTGCTGGAGAAGGCTAGAACTCGGAGGCGCAAGAGCGATAGTGGCGGCTGTC
GGACTCGGCCGCAATCTAGTCAGTTTGTAAGCAAAGCATTAGGCGGTGCTGTACCTGTGAAAATGGATATTAAATGATTTGATATGGGAGGTTACAGATT
GTTATCACAGCTAACAGGACTAATTAATTATATATGTATGTCAATAGTGAAAAGATAAAGAATTTGATATGGGAGGTTACAGATTGCTATCACAGCTAAC
AGGACTAATTGATTATATATGTATGTCAATAGTGAAAAGAATTATGGAATGAAAACGTTAATATTCCTCTTTAATCTGGTATTACTCACGGCTTGGAGGG
TAAAGTCGTGTTCGTGGGCTGAAAAAAATTGGCTTGTGGTCTGGAAGTGTACTTTTGCTGAGAAGCAACAACTCGCAATGCATCGTGCAAAACAGACGCA
GTACTTGAGCTCCATGCATGATAGAGATGTCGGCGTTTGAAGATAAACCGTTTCATCGCGACTTTCGTCGTTGTGTCACCACCTCTAGCATTTTTTTTAC
TTTCATTAGCGGCATGGAAGGTGATGTTGTACCAGGTGGTGTGGTCATTGCCGACGGGATCATGTTGAAATGCCCGACAGTTGGCAGGTCAAGCGGACAT
CTACAGACGATATGCAGAGGATCGAACTGCAGACAACGTATCCAATCTCACGTCACGTGGCAGCGACTTGGTGCAGTGCTGCTGCGCGCACCTGACGAGC
AAGCAGGCGACGAGACTGTCCCTCGCTGTCGTACGATTGTCTCGCCAAAGATACCTCGCGAGGTGTCTGCAGCAAGGAGGCAGCGACGTCGACAAATGCA
GCGGGGGCAGGTTGGCCAATTCGAGCACAACTTCAGTCCAGTTGAAGTGGTCAAAATCATGGAGTATACCTCCGATCTTCTATATTGACCGCATTCAGCA
ACGTTACTTTCGCCGCTCGGTGAGGCAATGGCTATCGCAGTGGCCTGCTTGAGTCAATATCCTACAATATCGTAGTGACTGATCTGCCATGTGTAGGCGC
TACTGGGCTATTGTCAGTGTGAGCGCGAGATCCCGTGCCAGTCGCAGGGTTTCCACCAATTGCTGGCGGTAAACATCTATTTTAGCCAATCGCGAGGCAC
GAGTTGGTCTCACCGCTTAAGTGCGAGAGCTTCGACCCAACCCAGAGTCTGTTCTCGCAACCGAAGAAAAACTTCCAGAAGACCCTATTTCTGCAACGTT
CATACAATTCTCAAGTGTCTGTTCAATCGGTTGCTCAATCAGAGCATCCTGAGAGCTTTCTCCCCCTTCGCTCCTGTCATTTTCCTTTCGTAACAGGAAG
CAGCAGAGCAGCGTCGAAGGAGAGGAGAAGCAGAGCAAGATGGCTTTAAAGCGGATCAACAAGGAGCTGCAAGACCTGGGCCGTGACCCACCTGCTAACT
GCAGTGCTGGCCCCGTGGGCGACGACCTCTTCCACTGGCAGGCGACCATCATGGGCCCCGAGGACAGCCCGTACGCCGGCGGCGTGTATTTCCTGAACAT
TTACTTCCCGGCCGACTACCCGTTCAAGCCGCCCAAGGTGAATTTCACGACGCGCATTTACCACTGCAACATCAACGCCAACGGCGGCATCTGTCTGGAC
ATCCTGAAGGACCAGTGGAGCCCTGCGTTGACGATCTCCAAGGTGCTGCTGTCGATCTGCTCGCTGCTCACGGACGCCAACCCGGACGACCCGCTGGTGC
CTGAAATCGCGCAAATTTATAGAACAGACCGCGCGCGCCACGACGCCACTGCCCGCGAATGGACCGCCAAGTACGCCACTTAGAGCACGCTAGGAGTAGG
AGATCTTTGTCCTGTCCACGTGTCGCCAGCGGAGCTACACAAACAGCTAGATCTTTAGTTGATGTAGCAGAATCTGCAGGGCCAGAAGTGGAAGATGAAG
ACAGTCGGTAAGCAGCAGGGAAGTGCAAGCTAGCGAAATCTCAGTTTGGTTTGTTTTTCGTGCTGAGTCAGGCTCTTGCTTTGGTTGAGTTCCGGTGTGT
ACACTAGGATGGTTCTGACACTGATGAATTGGATGAATTGAAGATATTGCTGACCAGACCGTAGACATCTTTGTGGTTTTACAGCGCGACGCGTGGTTTC
TTGACTTTATGACTCATCTTGATCACCTGCTCCACTATCTTCTCATTTCCCCCATTTTGTAAGATGAAACACCATATACTTCCATTGTCTCCCTCCTGCA
ATGGTGACGAAGCTATCCTAGCAACGCTGAGTCGTCTCATCAAGACGGGCATGCACGCGTTCTCTATTGTCATATTATTCTGTTATATTTGTCCCAAATT
GCACAATTCAAACGTGAATTTCGCATCTAGCAACAATGGCGACCTTCTTCGACAGCTTCTGTAGCTGGTGTCGCTCGGCACGATGGCAATACAGATGCTC
GATGTGCGACCCGCGCATGGAGAAGACGCTGTGCTCCAACTGCTCCACGTTGTGGCACTCGCGCGGCTTCGCACGCACCCACCAGCTCACGAGCAGCTAC
GGAGAGACACGCTCCTTCTCCGCGTGGGGTTTACAGCAGGATCAAGGCGTCAGCAATGACAACGACAGCACTATGACGGAGACGAAACCTGCTGCAAGTG
AGGAAGGTTCTAGTGATACCGCGGCTAGCGTTCAGGCGCAGGAAGTTGCTGTTAATGGCGCAGAAAATACTAGCGAGGAAGAAAAGTCGATGGAGGAGGC
TACGTTGGAAGATAAAAGCGGACAAGAGGAAACGAAGCAGGATGAAGACGAACCGATGGAGGAAAATTTCGATTTTGAAGTGGTCGGTGAGTCTGTTGAT
AGTGGAGAGGACACGATGAGTGTTGAACAGACTGATGAATCGGAAGACAAGGGAAAAGATGCCGCTGTGGAAGGAAAATCGTTAGACGGAAAAGCAGAAA
CAGCGTCGATTAAAGTGGTGGAGTGCGCAAATCCAAAGGCGGATGAACAGTCAACGTCGAGTGGTGATCAAGAGAAAATCACGCAGCAATCGTCTGCAAG
TGCTACTCTCCCAGCTTTTGCTCTAGAGACCAAGGCGTCAACTCCTGCTCCTGCTCAAACTTTAACTACGACTAGTGCTCCAACTTCATCTCCGGTGCTG
TCGCCAACTCATACATCTAACCCCGCTCCAACCGCTGTTTCGATTCCTGTGGGTGCACCAGCCTCATCCGTTCCAGTTTCGTCCACTCCAGATTCTGCTT
CTCAAGTCAAAACGCCTACAAGTACTCCTGCGGCTGCAGGGCAACCGCGCACTGAGCGATCCTCGCAAGGCAAGCCTGTTGATTTGGATAAACTGCTGCG
CTGGTTCCCCACAAAAGATCCCGTACTAACGGAGATGCTGGCATCTCGAATCGAAGAAGCTCTTGTTGTAGAGGATGCACTCATATGCGCAAGAATTCGG
AAATGTGACAAGCCATCGTGCTGTTCTGTGCTACTTCACTACGAGCATTGTAAGCGTGACGAAATATGTGGCGATCCGAAGTGCTTAGAGATATCAATCG
TGTACAAGCACCGACGTGCTTGTTTGAAGAAGGACAGTTCGTCTGCAAATGACGAAAAGAGGAACGTGTGTCCCTTTTGTATTCGTATTCGTCAAAGACG
GAGCATTGGCGTCTGTGCCGCACTAGACCATCTAATCAGTGATCAACGCCGCGCGCTTCAAGGTGCGCACAGTGAAGCAAACCGCAACTTTTGTTTACAG
AGCATCAATACATGGAAGCAACGCAAGCAGCTACTTCGTGATGAAACGGCGAGGCTCAATCAACTTGCCATTGAAAGCAGCACTCCGATTTTTAATTTCC
CAAAGTATCAGTGGCACTTCAGCGATAGTTTATTTATCAAACGGGAACCAACATCTCTGGAAGTGAACATCGATACACCAACTCAAGGTGTAGCTGAGTC
GTCAACGAACAATAATTTGATGCCCACAGCCGAGCAACATACTGATGTGCAGGTAGATGATGGCAGCAGCTTTACTGCAGGTATGTAAAATTTGCATGCA
TGCAACTCTTAGGAGATTCCTACCAAGAGTGATGGATTTCTGTGTACTAATTATTGTATTTTGTACGGTTCTTAGATGATAGCTCAAGTACTCAGCAGTC
AGAGGACACACAAGAGGACAGTATACCAGGAACCGCAAACTTTAACGCTGATTTTATCAACCAGCTCCTACGAGTCAAAGCAGAAAGTGATGATAACAGT
GAGATGGCACGGCGAGAGTTTGATGGAGTTATGGAGTTGGGTTATGCCATTGTGGACGCATCATTTTGTGCACCTTCCAAAGCACAACGATGTCTACTAA
ACTGCAAGTCGATCCTAGATCATCTGCAACACCACCTAGATCTGCAAGTGTGCAAGCAGGCAATGTGTGGAGCAGTGGAGCATCATTTTGCACATCTGTC
ACAATGTAAAGCCCGCAACGAGAGTGAATCCTGTGAATATTGCTTGAGAGTGGAAGAACGCCAATTGGTCCGTTCCGTCGACTTCATGGAAGCGGAGCAA
CCCGAGGCTGAGGCGAAAGTGCAGAAGATTATTAACGATATCACGGCCTCTTTTACAAACCACCACCCTGATGAGCGAGAGCAGGAGGTTATACAACTGG
AAGATGAGTTAGATCAAGCAGAGGCTAACAAGCAAGAATTGCTCGATAAACTCGGTACTGGACGGTCTAACCTCCGCAAGGTGCGCAGAAACATGGAGCA
TCGTGGAATTTCAACCTCAACAAGTCGTCGACTCCCAGTGCACTTCGCGAAGGCTCGACGCTCTGAAGGACCAGGAAATCACAAAAAGCGGCGCCTCGCA
GACTCGTCTGAGTAGGCACGTAGAATGGTAGATAAGATGCTCTTCATACACAGCAAAATGAGTGCTAGCAATACCATACGATTGTGGGAACGTTTCAAAG
TCAGATTAGCGTCGTCCCATCCAAAACATGATACGCATCGACATGACCTGAAAACATCGTCTTTGCTGCGTTGTGGAGGGGTCTTCTGTTTCAGCAACAT
GTAGATTAAAAGCTGCTGCAGCACCAGCTAGATTGGTTTGCGTTGCCTCCATTGGCAGCACTTGTGGGGCGGAAGGTGTCGTTGCGCTTCTTCGCCTCAG
ACTTCCGTTCGAAAATATCTTGGTGTTCCAGGATGCCTGTAACCAGCGCCTTCGCGGCATCATCAATGTGGATGTTCTCCTTGGCGGACGTGGCAAACCA
GCCCGTGAAGTTGTTTGTTCTGCAGAACTCGTCCAGGAAGTCCCGGTCTACATCTTCCTTCAGGTCACACTGCAACAATCAGGTAGTCAGCATCTCCACT
ATATCTAAAGCACCATCAAATCATCGCAACTCACCTTGTTGCCACACAAAATTACTGGCAACGGTTTGCCATTCGGGAGTTCGACCTTGGAGTCGATTTC
CTTCTTCCACTACAGTATCAAAATCATATAAGACCACAGTTCCAATAACAACATAACTGTCGAACTCTGTACACCTTCAAGATGCTGTCAAACGTCTCGG
GTCGAGACATGTCGTACACCAGCAGCGCTCCCAGAGCATCCTTGTAGTAGACTCGGTTGAGCGCGCGGAAGTGTTCCTGTCCAGCAATGTCCCAGAGCTG
CAGACGCACTGTTGTGCCGTTCACTGTCACCGCCTTGAGCGCAAAGTCCACGCCAATCGTCGTACGGTGGTGCTCTGAGAAGGCGTCGTGCACGTATCTG
CAAAGCAGTTAGCCCCTCGATTCGTCAACTAACGAAGCTACACAACGCACCGTTTGATAATACTCGTCTTGCCCGTTGCGGCATCGCCCAGTACTAGCAC
CTTGATGACCGCATCCTGCGCGGCATTCACTCGACGCTCGCTCATAGCAACCCAGAGATATCTCGAACTGATTCTGAAAGAACAACTATGACAGATCGAT
ATCTACGTACGTACATCAGTATGTGTAGTCCACATCGTATATCCGAATTTAGTGTGTATCACACAAACGTACTTACACACCTCTATTATCTGATACCGTA
CTTAACTCCAGGGCGACACATCCCAAGCCAAGCTCAGGCATCCCGCGCCATGAGCGACGACTTCGAGCGTGTCAACATCCGTACGCGCCCTCGACGGCGC
AGTCGCAGTAGCGGCGCCATCCTCAACACACCTGTATCCGACGCTTGCAGCTC