Description :
From Genome Similarity Track
Location :
Scaffold_1866:2579- 4095
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1866-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1516 bases(100 bases per row)
TCCCATCAAACCCAGCAGCCCCACCCCTCTTCTCCCCAGTCTCCTCCAGTCCAGCAAGTCACCATGGGCGGCAAGTGGTTCACCATGGAAGACGCCAAGA
TCTCCTTCAGTCTCTTCTGCTGTGTCTACGGCATCGGTACGCTCGGCATGCCGGCAAACTTTTCGCGCGCCGGCCCGTACATCGCCACAGTCGCGCTGGT
CTTCATGGCGTTCGCCAACGTCTACTCGGGCGTGGTCTGCTCCAAGGTCATGCTCATCGCGCCAAAGTCCGTCAAGACCTTCGGCGACCTCGGCGAGTTC
TGCATGGGCAAGCCTGGTCGCTATCTCGTCGTGACCTCCCAGATGGGCGTGTGTCTGCTTGTGCCATGCGCGTTCCTCGTGCTCGGCGGCACGCTGCTCT
CCAGCCTTTTCCCTGGCTCGTTCGAGCAGACCACGTGGATCATCCTCATGGCGCTTATGGTGCTCCCAGTGTGCCTGACCCCGACTCTCAAGGAAGGAGC
GGGTGCAGCTTTCGCCGGCTGCATGGGCACACTCATCGCTGATGTCATCGGTGTCGCTGTTCTCGTGCACGGCATGAGCGGCCACCCATCGGTTCCGACC
CCAGATCTCTCGTTCAAGCAGGTCGCCACCACGTTCGGCAATTTGTCGCTCGCCTACGGTGCCACGATCGTCATCCCAGCGCTCCAGCGCCAGCACAGTG
ACCCAACGCGCATGCCTCGTATTGTCGGCGTGACCCTGACCTTCATCTCGGTCTTGTTCTTGGCTCTGGCTGGCTCGGGTTACTCGGCGGTCGGCTGCCA
GATCTCGGGCAACCTGCTCTTCACGATCTTGCCGGACCCCATCACCGGTCTCACCAAGCTCGGCTTCCGCGCAGACCAGGGTATGGTCGTGCTCGCGTAC
CTGTTCATGCAGCTGCATATCACCGTGGCATTCGCTGTCATCGTGTCGCCAGCGTTCTACATCTCGGAGCGTCTTGTGTTGGGCATGCACCAGCGTAAGG
AGGACGACCTCGAGGCGCTTAACTACGAGTCGGTAGACACCCCTGCTGACTTCAAGCCACGCACGTCGAAGGGTTCGGTTGTGTCCATGGCCGACATTGA
GAAGGAGTCGCTCGACGAGGAGGTTGAGGCTGCGGAGTACAAGGGTGCCAACGCGCTCAAGTACGTCATCCTCCGTTGCGCGATTGTCACGCTCCAGGTA
GTCTCCTCGGTGGCGCTCAAGGACCACTTCTTGGACCTGTCGGACTTCATCGGCGCCTCGTGCATTACCGCGTGCTGCATCATCCTGCCAATCACATTCT
ACCTCAAGAAGATGTGGAACAAGGTACCAATCTACGAGAAGATCCCAGCCATCCTGGTCGTGATCGTCTGCCTCGTGCTCGGATGCTACGTGACGTACCT
CTCGGGCAAGCAGCTCTTCAACCCAGACGAGGTGGACCCAGAGATCCAGTTCCCGTTCTGCCACCCAGAAGACGAGGGCCAGATCTACTACAACGCCACC
GCGGCCGGCCACTAAA