Description :
From Genome Similarity Track
Location :
Scaffold_96:25787- 34237
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-fgenesh-gene-0.5Protein kinase
Pytir_DAOMBR486snap-pir_contig_96-abinit-gene-0.90GJ15230

Sequence
8450 bases(100 bases per row)
ACGACCTCTTCCCGATCATCAACAACAGCGTGTTCACGAATCCAGACAATATCATGCCGTCGCTGCAGGACGCGATCATGATCAACGACATCCGCGAGAA
CCTGTCGAGCTTCCACAGCACCAACAACAACCAGAACAGCATCACGGTCAACCAGCTCTCGATCGGCGCGGCTTTTGGTGCGGGCGGCGGGATCGCACGG
TCCGTGGCGCCGAGTGCAGGACGAGACCCGTCCTGCCAGTCGTTCACCGATGAGGCACTGCGCAGCAGCACATCCGGGGACTCGCTCAGTGACACGCTAC
AGACCAACGCGTCGTTTCGACTGCGCACGACACCCAAGGAGTGGCTACGCTCGCTCTACAAGCGCTTCAACACGAACTGGGACTCGTACTTCCTGCTGTT
CACGCTCGTGCTCTCGGTTGCGGCCGTGCCGGTCGCAGTGCTGATCGCCGCGGTGCTCAGCTCAAACTCGGACAGAGTTTTGAAGCCGCGATGCCAGCTT
TCGTACGCAAAGAGGGGCGACGACTACATGACCTCCATCGCAGCGATCTCAACAGTGACGATCCCCATACTGAACCACGCCGTAATGCTCGTCGTGTCGC
TCTGGATCGCCATCCGCTGCAGCATCAGCAGAAAAAGCGTGCTGCGGAGCAACGCGCAGGCCAGTGCGCGCGCCAACCTGAGTGAGTCTTGCGTGGGAGC
TTGGATCCATTATGATATCATTATCCTAGTTTGATGTGGCATCACTAACTAATTACCAACTAACGAACCCACTTCTCTTTCTTTCTCTTTATGTGTTAAC
AGCGTCGGCGTTCATGCTGCCGTGCTATGAAGTGGTCTGGTACATGATTGCACTTATGTCGCTCACGGGCGTGGTGCTGTTTATTACGAGCTTCCATCGG
GTACCTTTGGGCGCGACTCACGATGACCCACAGTACCCATGCAATGTCACGCTGCTCCCGCTCCTGTGGATCCTGCAGCTTCTCCCCATGCTCATGGTGC
AGCGCAGCGTGTCGCAAGAAGCTGTCGTGCGCTCGATCGTGTACTCTGGCGCAATGTGTATCGTGATACTGGTGCTCTTCATGAGCCTCTATCACCAGGG
AAACGACGCGGTCAACGCGATCACCATCTCCGTGCACTTCGTGCTCTTCTGCTTCTACTTCTGGGCCAAGTTCGTGTTTAAGGCGCGCTCGACGTTCGAT
TTCTTCTTCATCAGTGGCGTGTTGGGTGGGCTCGCGAGTCTTATCGTGCAGGTGATGGACATCTCTGGCATGAGAGGTACCCAGGATGAGTTCATTGGCT
ACTGCGTCGTTAACAGCTTGTACGCGATCTCGGTTGTCGCAATCTTGCTCTCGCTGCGCGCGGACACACGCTACTGGCTGGGTATCGACGACGGCACGGC
GCGCACACGTAACCCGATGCGCCAATACATGCGCCAGCTGTCGGAGCGCGGCATGATCACCAACTTCTCCACGCGCACATCTGTGTACGACGTGCACCGC
ATGATCGAAGAGCATCGCAAGAACGTCGTGGACTTTTCGGCACTCAAGCTCGCGGGCATTATCGCGCAGGGTGCGACGTCGATCGTGATGCGAGGCGTGC
TGCGTGGAAACACCGATATTGCGCTCAAGATCTACACGTCCGTGCAAGTCACAGACGAAGAGCTCCACAGATTCTCGCGTGAGACGGCGCTGAACGTGCA
GCTCTCGCACCCGAACGTGGTCAAGTTCTACGGCTTGTGCGTCGTCCCACCGTCGATCTCGCTCGTGTTTGAGTTCTGCGAATACGGTGGTCTCGACGTC
GCGCTGCAGAACAGCTCGCTCTGGGGCCTCTCGACCAAGCTCAAGGCGTGGCTCGACGCGTGCAAGGCCGTGGCATACTTGCACAGCTTCTCGCCGCCGC
TGCTGCATCGTGATATCAAGACCGACAATTTCCTGCTCGGACAGGACTACTTGCTTAAGCTTGCCGACTTTGGTGAGGCAAACTTGTTGAGACCGCGCAC
CGATGGCACGATGACGATCGCAGGTACGGTGGACTACATGGCGCCAGAGATGATCCTCGGAGGCAAGACGGCCCGGTACGGCACCGCGGTCGACACGTAC
AGCCTGATGATCACGCTCTGGCAGATCATGGTGCCGGACCGCAGTCCGTGGGACGGCAAGACTCATCTCGAGGTGTACACATGCGTGAAAGACGGTGAGC
GACCGCCGTTGCTGCCGAGCATCCCGCAGGGCTGCACCGAGATCCTCGAGAGCGGCTGGGCGGCGAATCCTATGGAGCGCATCGCTGTCGAGGAGCTCAT
TCCGAAAGTGCACAAGCTCTGGCTGCTCTCGCTTCATCAAAAAGTGCTAAAGCGCACAAACTGAGAACACACACAGAGTGCTGTGCTTCCACTTTATCGT
ACTCCTCTTATTTAAGTTTAAATACATGCAGTAAGATCTTACCTCGTTGCTTTCAACATCCCTTGTTTGCAGTTGGTCTTGGTTACAACTCTGTGAGCGT
ACTTGTGGTGCTTGAGTCGATGTTCTCCTTACTTTGCCCACCCTCGCCATCAGCGCGTGACTTGTGCCTGTGCTTTTTCGACGACGATTTCTTTCGAGAC
CCTGACGGTGTCGAAGAGTCTGTGGCCGATTTATCCTTCTTCTTTTTCTTCTTTTCGCCTGTGCTGCTGCTAGAAGCTGAGCTTGAAGAATTTGGTGCAC
TCAATTGTTTCGACGAAGTGCCTTGTTTCTTGAGCAGTTTGTCGCGTTGCGCCTGGCGTTGCTTGAGCTGCAATTTCTTTCTGCGTTCTTTCTCTTGCTC
CTGCATCTGCTGCCAATCGGCTTCTGCTTTGACTCCATCGCTCGGCTCCAGTGGCAGAACATTAGTGTCCAGAGGTGACGACACAGCCTGTTCCGTCGCG
GTCGATTCTTGTATAGTAGTGTCAATGCTGCTATCAGTCGAGGGTTGCTGCTGGACTGGTGTTGTTCCTGAGGCATACTTTCCGAGAATGAGTGCTTCAC
CATCGTCTTCTGCAGCTTTTTTCTTTGGCATTAACATTTCAGCCAAATGATCTTGGGTTTGAACAGCTCGTTTCTTTGGCTTCACCTCGAAACTGAAGGT
TTCAGAGTACGCGTCCTCGCCGTCTGACCCCTCATCGCTTTCATCATCAACAACGCCGGATGAGCCAAGAGATATGCTGTACACATCGGTCGACTGGTCG
AAGATACCCAGTGAAACGTCCTCTACGCCCGCAATATGTGTGCTTTTTCGTGTCGAAGACCTCGCTGGACCAGCCAGTGATGTAGAATCCTCGGCTGCAA
CTATGATGGCCTCAGCGGGGATATCGACAGCTTGAACAGGTTCTGGTGCAGCGGTTTGGACTGGGTTCTTGAACGACGATTCATTTTCGCTGCTGGACGG
ATCCGAACCCAGCTCACCGGTAGAATTCTGAGTTGATTCGATCACGCTCTCTTCAGATGCAGAAGACTCCGGGATATTTTGGTCGATTGCTTCGCCTTTA
TCAGCCAAATTTGGTTCACCACGCGGCGTCGAGGACATCACACTGTCATGGTCGCCAAAAAGGTTATACTGCTCTGTGGCAGCAGGCAGATCGCTTTCCT
CAGCAGAATCTCGGCTCTTGAACACCTCGTCAAGACTCTCGAGGGTTGGTTGAGAAGATTCGATCTCCTCTTTTGGCTGATCTAAAAAGGATACACTTTT
TCCTCGTGGCATCTTGGTCTTGAGACTCAGCGCAAACTCTTCGTCCGAATCAACCACGTTCAGTTCGTCCTTAGCAATCAGCTGATTCTTTTCTTGAACG
GCTGATTCAGACGATGCCGTGTCTGAGAAAACTGGTCTGACGTCTGGCGACGCGAGCTTGAGTACACTTGATCGCCCTTTTTTCAGCGTGAGTGCAAACT
CTTCATCCGAGTCAATCTCACTGTCATCTCTAGAAACGGATGCTTCTTTCTCGGTTTGAACTGCACCACTGACCGTTTTCGTTTCTGCTACGCTGTGTGA
TTCAGGCTGGGATCTCCTCTTTTTTGCTTTTGCCAGGCTGAGTGCGAATTCCTCGTCCGAATTGGCTTCCTCCGTCGCGGACATATCATCAGGTGGGGTG
AAATCGCTCGACTTCGCCTTCGTTATCTGTGAATGCTTGTTGTCTTCAGCTTCAATATACTCCACCTTGGTTTCTTCAACTTCCTGATCTCGCGATTCTT
CTGGCGTGTTTTTCTCATTACCAAAGTCAAAAAAGTCGGTCACATCACGCTCGCTCGAAGAGTCGAAAAGCGTGTCAATTGGATCAAACTCCACACGAGT
TGATTTCGCGGACTTTTTAGACCGTTGCTCTTTCGTATCTGTCGGCTTTGACAATGCTTTCACGTGAGGAATCGGCTTCGCTTCTTCGTCCGAAAGACTG
ACGGAATTCGTAGCTGCTCTGAAGACAGGTTTCTCGGTTTTACGCTGGCTTGAACCTTTACTGCGATTCTTCAAAGACGGGTAGTCTTCTTCTTCTTCTT
CCAGGTCTCGTGCACCACGATCGCGTGGCTTCAAGGACGGATAGTCTTTTTCGTCGTCGGACTCGGGTTCTCTCTCAGCATTCTTCTTTCCTGTGCTCGT
TTTAGCAGAAGTCTTAACCGAGCCATCTCGACGCCGTCGTAGCGGTGGTGCATCCTCGCCATCACTGCCACTCTCTTTGCCTGATCCTACCTGGAACAGC
GACTCGTAACCTCTTCCACCTCCAAGAGCAGAGCCTTCGATCGGACTGTCCTCAAATAGATCTGCGAAGGAATCACGACGTTTTGTTCTCTTCTTCTGCA
ATTTCCGGGACTCTTTAATCGGAGAAATTTCCAGAGCACCCTTGTTCTTTGTAGATGTCTTCCCATTCTTCTTGCGGGCAACCATATCTTCGTCACTGCT
ATCATGATCAAAGATGCTCAGCTTTCTGGAACTTTGCTCGTTAGCGCAAGGCGGTACTGCTGCATTGCTGCTTGAACGATGAGTTCTAGTTTGCGATTTC
CTGCTCGTACTGACTGGCTGATCATGATCCCTCCTCTTTCGAATGAGCTGTTTCAGTGCTGCGAGCTCGCCTTCTAGAGAAGATATTTTGTCCACGATGG
TATCGTCAAGTCCATCTTCATTTTCGCTTTCCGCAGCAGCTGGTCGGCTGTCATACTGCTGATACTGTCCAAGGGTGAGTTCTCTGCTGTACATCTGCGA
TTGCGGCTCTTGCTTCGAAGACTGCGAACTGTAATCGCGTCTCGTTGGTTGCTCACGGGATCGCTTTGGAGCTGATACCGATACATACCCGCCAGTAATA
GGATCAAACACGTAGTCGTTCGGTCGCTCAAATTCAGCAAAGATGTCGTCGACTGAGTTGGCCTGTTGTGCTGAACGTGGTGCGGCAGATACGTGATGGT
TGATATCATCCATGATGCTGGTGTGCGTGCTTGAACCGGCAGTATAACCCTGATCATCTCTCGCGTAACTCGAAGCAAACCGATCGCTTGAAACGCTTGA
CGGAACTGCGTACGTCGCTACTCCATAGCTAGGCTCTGCGGAGATTGCGCTCCAGGAGCTTCCTGCTGCTTGACTGGGTTCACCATTCTCTCTTTGTGAA
GACAATGAGCTCTCCCCGAGACCGATTGAAGAGGCTCTGGAGCGATCGATAGCGTAGATACTGGGCGTAAGCCCCTTGATTTCGTGCTCTTGATACGCTC
CGAAATCATCCTTCCGACGATCAAAACGGTCCACTCCTGTGGGAGGTACCACAAATGGTGACTCCATCCCAATTCCATTCCACGCTCTCGCTGGTTGGCT
TGCACCATTCGAAGATGAGTTCGCTTGACTTTTTGGGGAAGCAAACAAATCGTCAAACGTGTCTCGCCTTTTCTTCTGGGATAAATCTCGAATCGAAGCT
GCACCCGAGAATGTCGAAACTCGTTGCTGCCCAGAAGTTGGTTGTCGGAAATCGCCCCCTAGAGTTGCATATTCAGATGCCATCGTGTACCGAAATTGAT
CTTGTTGACCACTTTCATGGTAAGGTACCAAAGCGTTTTCCCCCATTGAGAAACGGTCAAACGACCCAGCTCTCTGCAAAATGTTGGATTCGCGGAGAGA
TGTCTGACGCTCAGCTGCCAAAGAGATGCTCATCTGACCCGTATCAACGTTCCTGAAGTCGTTGGGATCCTTCTCAGTTTCAGCCGCTTGATTTGTGGGC
TCGGGAGCTTCTTGATTGACTTGCTTTGCCGGAGATTTCGAGCCAGAAATCCCGAATAGACGCTTCAAAGCACCTGTAAACCCGTGTCCACTGGATTCTG
GCGATGACACCGGCGCTTCTGATGTGTTTGTCTTTCCTGCTTCTTGACCACCTATGTTCTCTGTTGGAGGTTCAACAATACTGTACGATTCTTGGTCACT
GGCGATTGCACGAGGCTCAACTGATTTTGGTAGTGGCGCAGCTCCCCATTGGGAACTGTCGGTTGGTATCCGCTGCTCCCTGGTTGGTGATCTGAAGTTT
TCACGACTCACACGATCAAAATACCCTGGAGTATCATCGACCACCAATTCGTCGACATCTGCTTCGTAAAATGTTGGGCGAACTTGTGTGAACACGGCTG
GTTGCGCAGGACCAATAGCGAGCATACCTTGAGTACTGTCGGCTGGAGGCGGTGATGATGGAGACACACCCTTGTTCTCACTTGGCTCTTCTCGCTTGAC
TTTTTTCTTTTCTTTACGGTTCTCACTGCCCTTCTTTTTGCTGTGGACATGGAAAATGTCCTTCAGACTCGCTTTCAATGTTGGTCGTCCATGCGGGCTG
AATCGGCCGTCGGTCTCGTTCTCCGGCTGTTTTGCGTTTGGCTCTACAACCGGTGCTCGTCTGACAACAAGCTGCTGCTCCTCTGGTCGAGGCATCTCCA
TCCTTGCTCGCCGCTGGTCATATTCATCGTCACCTCTGGATGCATACGCGTCTATCGAGAGGGAATCGTGCACACCTCTAGACGGAACCCTCGCGCCACC
GTTGGCAGCGATAGTGTGACGGCTCATCGCGTCCTGCCATTCCTCAGCTGCAGTACGCTGCTTTGATTGAGTAGAAAAGTATCGGTTCTGGGTAGTATCC
TCTTGGAGGAAGTCATCCTCGTCGTGGTCAAGATTGAGGTGTCTATCTTTCCTTTTAGCGGTGCCATTTTTGCCCATGAGAGGGTCTGTGAACCAGGTAT
CGTCGGTCAAGTCGAACAGATCGCTCGACTGCTTTCGTTCGTCCTCTTCGCGCTCCTTGGGTTGCACGGCATGGACTGGCCTCTCTGTCTTCTTGTCGAC
CTCACTCTTTCTCTCAAACGGAGCAGTGACTTGACGGGCTTCTTTCTTCTTGTCGTGCTTCGGAGTAAAAGTCTTCTTGAGGCTCTCACGTAATTTACTT
TGCTTCTTCTTGGAGCTATTAGACGGAGTTGCATACGCGTACTCTGCATCGTCATCAGTGACAGCAGATCGATCGAGATTATCATCTGCATCGGAGTCTC
CCAAGCGATTCGCGCGCGCTAGTTCGTTATTGCAGGTAGTACAGACTCGATGCTTCTTGTGGCTGATCTCAAAATACCGAAACACAGAGCAGTCCGAGCA
CATGACATGTCCGCAGTGCCTAGAAAGTAAGAAATTCGTCACAGTATAATAGGAAAGTCAGCAACCACAAAAAGAAAGGACTCAAACGCATTTGCTGAAC
GCAACCTACCGGCAGTGATGCTTGCGCTTCATCAACGAGAATGAGCTCGAGCAAAGGAAACATGCTTTCACAGCGTCGTCGTCGTCCCAGTCTACGTTGA
ACAATTCCTCACTTCCTTTCCGCCTGATTTTCTGCTCTCGTCCACTCGCCGATCCGCCATCACCTGCTCTTCTGCTAGCGTTTTTCGCTTTTGTGTTCTG
TTTCTTCTGCCTCGCTGTCTGCTGACTTGTTCTCCTGTTATTTGACTCGCTAGCGCGACCACTTGGAGTAGCACCTCCTCCATGAGAGATGCCACCACCA
CCAGCGTCGGATCGAGAGTAGGTCGTGCTCGGGATACTGGAGACTGGACTCACGGGATAGCTATACGCGCCATTATCCACACTGCTTCGAGCGCTCACGG
GTGCCGCTTGCGGCTGGCGGGCGTGCATGTCTGTATCTATAAAACGTGGATCCGCTGCTGCTGCTGCAGTCGTCGCGGTTTTCCTAGTCGCGCTCTTGTT
TGGCGCATTGCCATACAGGTCATCGAAGTCCCCGTCGTCATCCTGCACAGAACGACGCCAAACCAGGATCCACATACAGAGAGACAGACGCACGGAGATA
CACAAGAACAGTCAGTGATCGGCCGCTGTCTATCTACACAAAATGATATGAAGCGCCTCGCGCGTATGGACTCGTCACCTCGTCGAAGAACGGGTCGTTC
ATGGCCTTCTTCCTCGTCTTCTTCAGCCCGCTCTTTCTCTCTTGAAGTGT