Description :
From Genome Similarity Track
Location :
Scaffold_39:25785- 27738
Transcript NameFunction/comments
Physo_135520hypothetical protein
Physo_135521hypothetical protein

Sequence
1953 bases(100 bases per row)
GTCTCCACTTGACACCGATGTGGCGGAACGGGTCCTCGAACGTTGGCAGCAGGATCTCGCAGAGCACTTTGCTGTCTTGGACACCGTCTTGTGTGCACGC
GGACTTGATCTTCATGGCCTCGTCGGTGGGGGCCACTACGCCGTACATGATGTCTTCGAGCTGGCCCTCGATGGTGCCGAGCAAAAGCAGCTGAGGTGTG
GTCGGCCCCTGCCTCGTGGCCACTACCCGCTCCTTGTAGACACGCACTCCATCTCGTCGCCGGACCTCGCGCCACCTCGTCGGGTCCGTGATACCGTCCT
TGGTCACGAGCAGCGTGGTATACTGCTCGATGTTGTGCGCCGTCAGCGTCTCCGCGAGGGTTGTGCAGCATCGTGGCGTGGCACGTAGTCAGCTCGAGCG
CCGTGCGTGGGTGAGCACTGCGAGGTGAGTGTGGTGGTCAGCGCAGAGGGAAATGGCCCGCCATGGTGAGTTGGCACCGACGTCCGTTTGCCGCCCATGC
TTCATACCGCGGTCTCCATGGCGGTGTAGCTTTGGTTGTGGATACTCAGTGATGACATTTTTTCGGGGCGCCCTAGTTGCACCACGATTCCAGAGCGTTG
TTAACCAGCCGTGGCGGGAAACTCTTGAACAGAGTACTCTTGGTCGAGGGATATCGTTCCGAGTATCGAGATCACTGTTGCCGGGTGGATTGTAAGGCGC
TTATGGATTTTTCCTCTTTTGATCTTGCAGATTTACTTGTCGGCCAGCTCCTCGCGTCATGCTACCGACGCGCAACATATTCAGCCGCTATACTAGTTTC
GATGTCCCGAAGATGGCGAGGTGCTATGCGGATTCAGCCCAGCTTCGGTGGGGCTGACGAGTCCACGCGTGCCCCCACTGGACAGCTTGCCATCTCGACG
CCCCTCATCAGCTGCGTCACCGACCGCAGCGTCCGATGTTGTTCCGCCCTCGTCTTCCGCTCCGAACATCGGATAAGAAGAGTCCGTGCAGAGCAGTGAA
CTCGCTACGTTTACGGTGGTGGTTGACCATGTTTGCGAGCGCTCCGGCGACAAACACGCTCAAAAGCACGGGCGAGGCGACTATTCTTCTTGCCTACTGA
CTCTTCTTTGATAAGGGAAGGCACGCCGGTGAGATTCAGCTGAGGCACTGGCCTCGAGCCTATAATTTGTTCTCAGAAATGACTTCGTTTGCACGAACTC
TGAAGTTGAGCGCAACGCGTTCGACAGTCTTGGTGAAGTGGGTGCTCACAGTCACTTTGGAGCCCCGCAGCACACTATGCGGCTCGTTCACTTGCTACCA
GAGCCCACCATCTCCAGGCAGGACTGCGTCATGCTGCAGAACCTGGCCGACACACTCGCTGGACACAACATCACGCAGTATAACACCCTTGTGGTGACTA
AGGACGGCCGCGCCGACCCTCAGCGGTGGCGCGAAGTCCGTCGACGAGGCAGCGTGCGCATCTACAACGAGCGCATTGTGTCATCGACGCATTGCCCCGC
GACACCGCAGCTCCTGCTGCTCGGCACCATCGACGGCAAACTCGAGGACATCATGTACGGAGCGGTGGCCACTACCGATGAAGCCATGAAGATTCAGTCA
GCTTGCACCAAGGACAGCGTGCGGGACAGCAAGGTGCTTTTCGAGATCGTCCCCCCTAGCTTTGACGACCCGTTTCGCACGGTAGCCGTGAAGTGGCGAC
TGTACGAGGGGCGCGACTACGTGTCCTTGGACGCCACAGGGATCGTGGGTGTTCGCGGACGTGAGCGGATCGGATACAGCATTTCGCATTCGGTGATTCT
GTCGGAGATCCCGAGCTTTGAGAACTCCCACAGTATCGAGCGCGGCAACATGTCTGTGTGCGCGCTGTACCGCCAGAAAACGCCGACGACGGTAGAATGC
TACGTGCGCGGTTTTTTCGACTTTAAGACGAAGAACGAAGTGCTCAAGAACAT