Description :
From Genome Similarity Track
Location :
Scaffold_163:2578- 8303
Sequence
5725 bases(100 bases per row)
ATTTAAGACTGATTTCTATTTAATGAATCAAATAGAAATCTAAATTGTTATTGGCTAAAAGACAAGAGATTAGACGTGCGCTCTGATGAGACGCCGTCTT
TACAGCGCGCTTAAGCTGAATATAAGCGCGCTGATGACGTACTTCAATGACGTCAAGTCGTGACGTCATCCGTGTGTGACACACACTTTGTGGTAGGTAC
GCAATTGCTGTACCCCAACCACATGAAAGGTCTAAGTGTACCGCTCTTAGAACCTTTCTCAGACTTTTCCGTTCCTTTACAAGGAAAGTCTCGTGCAACG
GTTCGACCCCGTTACGCAATCTGCCTTAAATTGCCTCTTCATCTGCTGCAGCTCCTTCTTTTTATTTCTTCTCCTCTTACACTGCATCTAGAATCTCTTG
GTCATTGAGTTCTGGCTAAGCACTCTCGTCTCCTTCAATATAGTTGATGAGCTCACCAATGGAAAGTCAGCCAAAAAGTACAACGTGTTCCCAACGAAGG
ACACCAGCCCCAGCAAACGTTCAGGATAGCTACGTGTCTCTGACCTTGGGTCACAACCTGAACCAATTTTACAGACAAAAGGTGAGGACCTGTGTGAGTG
GTATCTAGGGCTAATATAATGATGATTTGGGTGGATTTTAAAATAGGGGCGGAAGAGATGTGAGTGGTTATAGATGTGGTTTCACTCATGATCCTTTAAT
TATTGAATCTGCTATATTGATCTGGTAAATATTATTATTTTCTTAACCTTGCCATATTATAGAAGAGAGCCGTTAATGAGCCTTCAGTATTTTTTGATGA
GCCTTCACCCCATTCATTAATCAAGTAATCAAATTATAAGCCCTTAAAATTGTGAAATTGTTTACTTGTACTTATATGCTTCTTGTAACGGTGCCCCGAA
GAAACACACTGGTTGCCAGCTACTATCACCGACAGCAGTGTTAGTGATGTATCGCTACCTCTGTGCAAACGTGCAGAGGAAGGTAAACAACTAGGTATGG
ACTAGTTGCTGGTAAAAGTAAACTGATATTAATGTAATTAAGTCCTATTCCAACCTAATGTCTAATTAATCCTAACTTAATTAAGTTAATATAATTAAAT
GTATGCTGACGTCTACTCACCACCCATTGCACGCGTCTAGCAGCGATTGGTGGGCTGATATCAACAAATGAGTAGACCCTTGGGTCATCCCAACAATATC
ACTGAGTACAGTGATATTGTTAAAAGGTTATTCAACTCAATATTCTTTACTATCATTTATTATAAATGATATTTTTATGTAACGAGGCTACCCCGTTACA
CTTCTAATATCTAAATTTTTACGGTCGAGACTGATCCAGTCATATCTGCAGCCCCACATAGAGCAGCCCCATCGACGCGTGTCCTTCGAAGCATGTAAAT
CATTGTCCTGGGTATGCTGCTGGCACAGCCGCAAAATGTGCCAACATTAGAGCAGTGGGATGTTATGGCTGGATTACGTCCCCACGCCTCGCGCTCGCTT
CGGAGACTGCACACACCGTCGTTGGGACGCGCGAGAGGCTGGAAAGAACGATTTATCGTTAGTAAAGCGCTGATTCTTCTTAGCGCGTTGCTTGGCTTTG
CATACATCCGTTAGATCGGCCGTGCTTGCGATCGTCACTACAGCGATGTGCTGACATAGCAAAGCCTACCCAACTTATTTCTGCATAAGGAAGCGAACTA
CTGAGAGCACTTGTATATAGACTCGCACTGGGTTGTTTAAGTTGTATAAAATCCCGCGCTACACCTCGTCTCCATCCCTCCCTTAAGAGGAACACCCCGA
AAAGCTCCAAAGACGGCCGTTGATTTATGATACAAACATATTCAGACCATCTTCCACATTATCGAGTAAATCGACAATCTTGAAATATAATAAACATGTT
TTATACTTCTCACCCTCTAGATGTACTTGAATGCTATAAAAGATAGGGGAGCAAGCTCTGGACCTCGCCCTTTTTTATAACTAATTCAGTTTACAGAACT
GAATCAAGTTGCAAAACTATACAACAGCAGCAGTCACTGAAGAATGAGTATGATGCTGTTACTGTGCATTAACCCAGTACATCATACTTAAGCAACGTGA
TCGGCCTTTGCTTATAAGTGTCCAGCGTTTGCTTATGTGATCATATTCACCTTTGATCAATTTTAAGCCAATCACAAGCATCCGAGTCACTCATTGTCTA
TGTCACTATTGCACCACGATAGTGACCTAGCCAAAGAGTGACTTCGGTTATACATATACCCACGTGGGGGACAGGCTGGATCGCACTTGGGACGGGTAAG
GTACACCCAAACGAGTTATTTACAGACAGACAGACAGACACAGAGATAAGTACGATTTAAAAGTTCGGCATCCAACCTTGCGCACACTCACTAATAGGTT
CGCCCTTCGAGCTTGCAATAATCATATTTATGAATCGCCTGTTACGTACATCGTTGCATGAGCATTGCAGAATTACTACTTTTACATCACTGTCCTTGCT
TCTCCCAATTTTCATTACCTCTAATCGTTGTAATATAGCCTTCTGGCAGTGTCAGCTCGTCAAGCGCATTACACTCTTCGTCAACAAAAACAAATAACTC
TCCTGTGATCTGGTTAATGCTGTCCATGTTGCTTTTAAGAAGGCAAATGCTAAACGGCTAGGTTCATTTTATAGCAATTACTAAACGGCTGGGTTCATTT
TATTCGACTGGGTAATTCTGATTCGTTATCAGAAGTAGCTCAGAACTACGCCCAATTTAGTCAGGAGTAGATCCCAAATACTCAATTCACTATTACTGTT
TACTTACTTGCCCGTGCAACGCTCAAAATGAAGGTGTCAGTACATTTTCGCTGCTAAAACCCTACTCCAGTCTATACTCTCTGGTTAGCGTTCTCTTACG
AGAAAGATATCGCTTTTCGAGGCCATTTTGGACGCGATCGCTCAATTTAACACCACAACCTCACAGTCAACTACGTCCATTGAAACATGGTGCGTCTTCA
CAAAATTAAGGATCCCGTGTCGCATAGTATTAAGGAAATTCTATTTATAGCTGACACTATGCTACCAAGTTGCTGTCCAGGCTGGCAATAAAAATTGTGT
ATATGACATTTTAAATGCAGAGTATACCCTAATATGACGGACTACCAGGAAAAGGCTGCCATTCACATGGCGAACGAATCTCGCGACATGTTGCTGCCAA
GGTTGTAAATCACGAGGCTTACGCAGCGCCAAAGTCTGGATTATCCCCACACCGTTCACATCCACCACATTGTGTCACGCAACAAGGATGCAATCAGGGG
TTGATTGCCGCTTTATTCAGCATCAAAATTATTCGTCTTAACCTTTCTCAAATTCATAATAATCTACAGTGCCGTCACTCGCGTGCACTAATCTACGGCG
TGTCAAGCAATTAACTTCCAACCAAAACCAGTACGTAAACGACCGAATCGCTTATCGCCAAATATTTACTTAATTACTTTCTTTTAACGTTTATTAGATC
ACTTACTCCTTCGGATTCAAGTACCTATCTGGTCCACGCGCATTTTTACATTTTCCCCAGAATAATAGGAAGCGGAAAGTACATCTCAATCCATGGCGTC
TTCACAGAGATCGCACTCAGGACTCCAGCACTCGACCATTCGGTTCTCTTGACGTTGTAAGCGCACAGAAGCTACATTATGAAAGAAGCCACGTATCTGG
CTATTATATGAAATTAAATGTTCGCACGCACCGACGTGACCCAGTACTCCATCTCTTTGGCTGTACTTGCTTGACAAAACATCTTTGGTGCAGGTGTCAC
GACCTCGATACAATTGGCCTTGATATCAAAGTAGCTCATCCAGAGGATGTATCCGGCGTAAGATCAAGGCCACCTTTCATGAAATCCATGTCATCTTCTC
CGTAATAAAGGAATCACCACCTTGATTGCAATTGGGTAGATGCCCTTCTGCTAGTACGAATCAGCGCGTCTTCCAATTGGCAACGTGGACATACTGGGCA
CGGCCCAGTTCATGAGGAAATCCTTTTTACTCGAAACGAAGGTTTTTGTGGCATCGTCATATAGACACGACAAGGAGGATGTGGCATGTCCAAGTAAACC
GCAGACGGAAGTGGTGGCAAGGCCGTACTTACGGGTTTCTCAGAATGGATAATGTTGCGCGTACTAAAAAAAGCACCTGTGTTGTTGTTGCTTATAATAT
TGGAGTTCGGCCAGGAAGTAAGGAATGTAGTAGGGTTTTAGCTGCAATTGCACTGAAATTTTCTTTTTGAACGTTGCACGGGTGGGCATATTTCTGAGCT
ACTTCTGATAACGAATCAGAATGACCCAGCCGGATAAAAAATGAACCCAGACATTTACCAATTGCTTTAAGAAGGGGGGTCAGAGGTACGATTAGTAGGT
GATATGAGATTAACAAACGTTTTCTTTTGTAAATGTACAACAAAACAATCAGACAATTTAGGGTGTTTCAAAAATAAATACTTTTTTAACGAATGGGGTG
AAGGCTCATTAGCGGGCCCCTCTTTTTAATTTAGGAGCCGCTAATGAGCCTTTGGTTTTCCCAAATGAGCCTTCACCCCATACATAAATCAAGTAATTAA
ATTTGAAAATCGCTATATTGCTAAATTGTCTTAAAGAACTCTTTAGAAATAAGGTCCATCGATCTCATATAATCTACTATGTCGTACCTTTGACCTCCCT
TCTTAAAAGCAATATGGAAGGCCTTAAAACCAGATCGCAGTAGAACTGCTTATTTCTGTTCACAACGCTTTTTACACGCTTGAAGAGATGATACTGCCGG
AAGGCTATGTTACAGCAATTAAACGGCAACAAAAGGTGAAAAACAGCAAGGTCAGTGATGTTAAAGCAGGTGATATACAATACTCATGCAACGCTGTCCA
CAACAGGCGATTTATTAAGATGGTTATACTATAGCACTCAAGCACAATCAGAGGGTGGGCAACATATTACATGTGCATTTTGTTTTCACGATTATATTTT
TACACCTTAATGTGGAAGATGGTCTGAATACGTTTGCACCATGAACGATGTGCCGTCGTCGGAGCTTTTTGGGGTGGTCCTCTTCATAATGAGAGAGACA
TGGTGTAGGGCAGGGTGGTATTCACGTTAACGAAGCCGGTGCGAGCCTATATTTAAAGTGCTATCATCCGTTTGAGGATCTGCTTTATGTGGAGCTGCGG
ATATGACTGGCTCAGTCTCGAAACTTAGAAATTAGAAAAATAAAAGTACCTCAAACAATTTGACAATATAGGGTTTTTTAACTTTAACTACTTGATTTAC
GTAGGGGTTGAAGGCTCATTAGCGAAAACTGATGGCTCATTAGCGGGTCCCTTATTTTATTTTTTATGTGATTGAATTAGTATAATTCCCAATGTACCAT
AATCAAATAACTAATAGCCTCTGCTAACTTATAGATATGTGTATAACGAGGCTAAAAGTTAATAGAGGGAGGAATGTATACAAGCCTGAGCTCTGGTGGG
TGTTTTCTGGACCTGTCTGAATGCATAAAATAGCGATACCTAGACTATTCATCAGGGAGAGAGAAGCAGGTGCAAACTATACAATAGGCTCGTCCGCTAA
TCACTTGCTACCGTTTAATCGGAAATCAACGATGAACCACTTCCGAACCTGGAGCAGAACCCAATTCTCTATGCTTTTGACGCAGAGGTGGGGATTTTAC
ATGTGTAAACTAGAACAACTGCGAG