Description :
From Genome Similarity Track
Location :
Scaffold_970:2578- 4567
Sequence
1989 bases(100 bases per row)
TAATGAATAATTTAGTGTAGGAGACAAAGTACTGTTAAGCACTAACACTCTACCTTAATATGCAGTTTCAGTTCTACCTAATGGTACTACTAAACTATTG
CCACGATTTCTCGAGACTCTTACCGTGGTTAAGGAATTCGGAGACCTAAATTATAGGCTCAACCCCACACATACATGAAGACATACCCCTTATTGTACAT
TGGTCGTCTAAAGCGATATGTAGATTCACAAGAGATCACACGTCCGCATGGGTCTGACGTGAGCGATCACGTCAATGACGAAGCGACGAACGACGGTACT
GTGGAGGGGACGGCGTAGAGGGAATACTCCTAGCCGATGAGTGAACCCCGACCATCGTCGGTGTTGGTGAACGAGAAGTACTGCGCGTCGAACGTGCGTC
TCTCATCAACAAACGGTCCAGAAGTTCGACCCGAATCTTCAACCGGTCGTACCATTGACGTGCCTTNNNNCGGACGTCGTCCAAAGTAGATGTCAGTCGC
GAAAACTGACCCTCGAGAGCCACGATCCACTTCTCGAAAGCCGCTTCATGCGCTTGCGTCTGGTCAGTCGACGTGTGAGCCGCGAATAGAAGTGCATTGT
CAATGCTAGTATCGGACTCCACCATCACTTGTGAACGCTGAAGGGACCCAACGCTTCTTTGTAAGAAGGTTGATAGCCCACTATTGAAGGAAGCATAGCT
TTGAATTCTTGTCCAAAATGGAAAGGGTATCCAGGGTTTTGACTCATGGGAGCCAATCGACGCGTTGCTTGTCGAAGTGACTGGGCTGGTTGCCGCTTAA
GATCAGGCACACCATCTGAACCTGTTCCGCTAGATCCCAACGGACTAGCGGATGCAGCGTAGCGATAAGATACAGGGGAGGGTATATGACCACCCACTTG
CTCACGCGCACCCTCCAGCACGAATTTCATTCTTTGCGACCGCTTTCTCGCCGGCTTAGGGTGTGGCTTGGTACTTTGCAAGAATGATGATTCGTACTGG
TGGGTTGTTTCATTGAGAAAAAATACGACAGGAATTGAGAACGTACAGCCAAGCCTCTTTCCTTCTTCCTTTCTCGTACGGAAGACGCCATAAATTTATG
TGCGTCAATAGTTGCACGCGCTGGAACCGGTGAAACAAACCCATCCGCCACTGGCCATTCGGTTGGAGGTGACATCGGTGAGATACTACAAGATGCATAG
CGGCCTCTAAATTGGTGCGCTCGCGACACAGATGGACGGAGGTCCAGTTTACTTGTAGGAGCTTTATGCTCTGTTCGTTGAAGTCTAACTCACCATTGTG
GATGTACTAATGTTCGGACCAGACGTTTTAAATTCAAAGAAGCTGCTGATCCTTAAGGATAGAGCTCTCTTTAATGATCGTCGAGCTAATNNNNNNNNNN
NNNNNNNNNNNNTTGTTGTTGGTAGACTGTGAAATCACCGCAACATCACTACAGTTATTTACAGGTGCGGTTTGAGCATCGGGGATAGGATCAACCGACT
TATCCCGTTCCACACATGCTCAGTGTCTTCATCATCCATTCGTGACGGCAAGGCATTAGACTCATTCAATTTACCATGAATCCAGAGTCATCCTCCGCAT
TGGATGCGTGATGTGAACTGTCGCCGACTTGTCGGCGACGCGAATGCTGTACTGACATTCGACGTCGTGGCACTAGTATCTTGTGTAGTCTTCGTTTCAT
CGCGACGCACAATCTTCGTAGTAGAANNNNNNNNNNTTGGAGACGACTCAATCTTCTTTCCACGTTCAGATATCATGAGAACGCCACGCAGTGACGCTGA
GAGAGAGCACACTTCCAGGAAGTTCGTACAAGCAAGCACAGATAGAAATTGGCAAGTCTTTGACGGATCACTATTTAATGCTTCTCCTTCGTTGCGATAT
TTACAGAATTCGAACAATCATTTTGGAAGGAGGGGGTGGTGTAACGGGTCAAATCGTTAAAAAGACTTTTCGTTTAAGACAAGGAAAGA