Description :
From Genome Similarity Track
Location :
Scaffold_723:2577- 3604
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_723-fgenesh-gene-0.2Oxidoreductase, Gfo/Idh/MocA family protein

Sequence
1027 bases(100 bases per row)
CGATTCACTCGTTCCGTTTTCTTCGCCTCTTCGAGGATACGAATTTGGGGAACGACTTCGACTGGGTTCACCAGCAGCTTCTCTCCCGTGCGGATCGCAG
CGGCAATGTTGTTGTAGTACACGTCGTACGTCCCCGTTTTGCAAGGAATGACTTGTTCGATGCCATCAACACCGACAAACTTCCCGAACTGCGACTCAGG
TTCGTCTCCGAACCCTGCGTCTCCTGGACGCAATCCTTCACGGAGCTGCGGTTCTTGGATATCCTCGCCGTACTTCTCAAACTTTCCCTTTGACCCTTCA
ATGATGTACTTTGGTCCGATGTCTTTCACCATCATGCCCGCCGTGAGAATCACTTGCAGCTGGGGAAACTTGTTGTACTTGAATTCCAAGCGGAAGTAAT
CGTCGTTCTCAGCACCTTCGCGTTGGATTTGCACATCGGCATCGACGGCATCAGGCTCACCAAACAATTGCAGAGCCTGGTCCACAAGATGTGCACCCAA
ATCGTAGAGCACGCCGCCACCAAGTTCGGCTTGCTCCTTCCAGTACCCTTTCAGCGATGGACGGTAGCGGTCAAAGTGTGATTCAAACTTGACAAGGTCG
CCAAATGCGCCGCTGTCGATGAGCGATCGCACGGTTAGGAAGTCGCTGTCCCAGCGTCGGTTCTGGAACACGGCAAAGAGCACGCNNNNNNNNNNNNNNN
NNNCTCCTTAGCCAGGTCGACGAGCTCTTGCGCGTCCTTGGCCGTGATCGTCAAGGGTTTGTCGACCACGACGTGCTTCTTCGCCAGGATCGCTTGCTTG
GCTTGTTCAAAGTGCACGTGCGTTGGCGTCGAGATCACGATCAGCTCGACGGGGGCAGCGACCAACTCGTCCATGGAACGAACGATCTGCGGCGCTGGCT
GCAACACCGAGCTCTTGGACGTCGAGCGTTCGAGCACGTGCGTAAGCGCGAACTTGCCCGAGCTCATTAGCAGCGGCGCGTGAAATACGCTCGAGCCCGT
GCCGAAGCCCACGAGACCCACTGGGAT