Description :
From Genome Similarity Track
Location :
Scaffold_249:2576- 25765
Transcript NameFunction/comments
g5448.t1hypothetical protein
g5449.t1POM77341.1 Hypothetical protein PHPALM_5286 [Phytophthora palmivora var. palmivora
g5450.t1hypothetical protein
g5451.t1hypothetical protein

Sequence
23189 bases(100 bases per row)
TTCATCAAATGCAATATGTAGTTTGCTGCAGTAGCTGTTTTCGTCTGTAGTCTTGGGCTGCATTGCCCCAAGTACAGGTCATCATGATGACAACAAATGT
TGTCTAGTCCTCGTCAGCGACTTGGACCATCTGCAAGCGCTGTTCACGCTTTTTTCGCTGCAAGTAATCATACAACATGCCCCCGCACGAGAGGTTCGAT
ATGGGTTCCCATGTTGGCTCGTCCTGATCAGCCCATTTGATCTTAAACTCTCTGATCGATCGCGCAGTCCTCGTTGACATGGGCATTCGATCGTCGAGGA
TCTCCAGGACCTCGCTTTCACCAGCCAGCCGGTCCGGCTCCCAGCTATCTTCGGGCAGGAGTTCTTCATCAAAGTCGAAACGTGAATCCTCAGTCACATC
CTGCGTCAACCGAGTCCTCGGTCGGTCCTCGAACTCGCTTACTCCCTTCAGGCGTGACACATGAACCACTGGATAGAAACGATATCCACTCCGATCGGGC
AGTTCCAGCTCGTAGGCGTATTCTTACACCTTGTTCTTTACCCTGAACGGGCCGTGCCATCGGTGGGCAAGCTTCTTAGTCAATCCGGGCTTGACGCGCT
CCATATACAGCCAGACACGGCTTCCTGGTTCGAAGAGAGACTTCGTCACTGCTTCAGTATGTTCGTCGTCTGTTCGTTCGCCATTTGGATGGTTGTCTGA
CGTCTCATCGTTCGATCGTCGAGGTACAGCTGCCTGTTCTTTTCGACTTAAGGCTTCGTTATGTTCCTTGGCTCGACGCGTCTTTTCTGCTGCTTGGTAC
TCCTTGGCCATTTCAAGCGCTATTCCTTGCTGGCGATTCACCTCTCTTCGCCATGCTAATGCATCAGATTGCTTACCGGAACCTCGTCGTAGTGAAGACG
TCATTGCATGCAGCGACGAGTGAGCGTCCCACCCATGTACTAGGAAGAACGGGGTCTCCTTTCGCGTCGTATCTTGCGAATTGTTGATTGCGAACACTAA
TCGCTCTGCAATCTCGTCCCAGTCCTGCTGCAGCGGATCTTCGACGTACACTTTCACTGACTGCATGACGGTCTTTACTGATCGCTCTTGTTGGCCATTA
GCTTGCGGTCGATAGCTTAAAGTCGCTCTCGATCTCGATTGCATCATATCAGCAAAGGCTTGAAAGACCTAACTCATAAAACGAGGATCCCTGTCGTGCC
GAATGAGTGCAGGTGCACCGAAACGTCGGTATATGCATTCTTCGAAAGCTTGGGCCACCATGAGAGCGGACGTGTCCGACATAGCTTTGGCAACCACGAA
TCCAGTGAACGAGCACTGGAACAGTAGTAGCGCAGTGTTACCGCGTCGAGACTTCGGCAAGGGTATGACGAAGTCCATTGACACGATCTGGAATGGTCGT
TCGGCTAGGATATTGCCTGGAGAGTATCCTCGAAGCTGTGGACGGCTCTTACTGGAACTGCAATCCAGGCACGACTTCACGTGCTTCTCCACATCAGCGT
ACAAACCTAGCCAATAATAGTCCAACTTTACTCGCTGGTATGTCCTGACCACGCCTTGGTGGCCGCCTTCCAGCGAGTCATGGCAGTTCTGCAAGACTTC
TTGAATCATCGTTGTTGGTACTACGAGGCGCAGCTTGGTCTCTGCTTGCTGGTTATCACCTCGCCGACGACTTACTCTTAAGTAGTACAGCAACCCATCC
TTCGTTAACACAAACTTGTCGGCAATCTTCCAGGCATTTCGAGCTGCCTTGTAGCCAATATTTTCCAAGTTTCCGCGCAGTACCGATTTCAGGTTAGACC
ACCTCACTTCCTCGTCTTGGGCTCTGGAAATACGGCTTCGCCGCTCTTCCTGTACTGCCACTGGGTCGATGTCATCTGCGTTTACCGTCAGTGATTGCTC
AGGTCTGGGTTGTTCATTCAGCGTATTCTTGGTGGGTGCCCCTGTAGCATTTGTCCGCTCCGTCGGCTCAGTGAGTTGCTCAGAGGCGACTTCATCTGCG
AACCTAACACGTTTTGCTGCGCTGTCGTCTTGTCATCACCGAGACCTCGCCTAGCTCTAGTCGTACAAAATCGACGAATGTTTTGCGTGTCGACATCATT
TGGGCGTCCAAGACTTGAACGAAATTATCAGGACTCGGCGTAACCACATTGATGCTCTCTTGCGGGGCTTCATAGATCCTTTCGGGAATCCTATTCAAGC
TTGAAAGCTCGGCTTGCCTGTCTTTGCTGAGAACCACCTTCGATACCTTCATCTCTAGTGTTTCGCCTGCTAACGAGTCTGCCGCTGCATTGTACTCTCT
CAACACATGCAGGTACTTTATGGACCGAAGTTTCGCTGTAAGTACTTTGTGGCGATTCAATAATGCCATCAGCGACTCCTTCCTGCATGCGATCACCCCT
AGGGATTGCTGGATTGCGAGTCTCGAGTCTCCGACCACGGTCAAGTCCTCGGCACCGTGATCTAACGCAGCTTGTACTCCGTTGTTCATGCCTGTGTATT
CCGCAACATTTACCGTGGTGCTCTCGAGATACGCACTCGCGGCGATCACTATCTTCCACTCAGGTAGTCGCCACACAATCCATGAGCAGCTACCGTATCC
GCCGTACTTTTCCGTCTTCGCTGATCCATCAAAAGACACCACGAGTCCTCGGTGGTCGCGAGGGAGACGTGCATAAAGGAGTTCAGGGTCCATTCGTTGG
TGGTGCTACGAGTGCTAGCGATTCTTCGAGGTCGACAAAGTTCGTTATCGTCGACTGTAGGAGCTGGGCAAACACACAGTCTTTTTCTTTGACTCGTTGC
ACTTTCAGGTGCCATGGTGATAGCAACACCGAGAACTGTACTGCTCGTCCAAAGAGTGACTTTGATCGGTGTACCCAGTCGAGTGTCGAAAATCGTGTAT
ATACGTGAAGTGTCTGTCCGGCCAACTGAGTGTGACACATCTTCAGCAACAGCAACAATGCCAGGACCTCTTTTTCCGCCGGGAGATAGTTCATCTCGGC
TTCCTTCAAAACTCGTCCACAGAACCGTACGGGGTGCAGCTTGCCTTCGTGCTCCTGCATTAGCGTGGTACTTAACGCCCATTCATTTGCGAATAACATG
ACATGAACCGACTTGGATCGGTCAAAATGTCGGAGGATCGGCGCATCCGCCACCTTCTGCTTGAGCGCGGCGAAACTTCGTTTCGCTGTTGACAAGTCAC
CTTCGGGTCCAAAGTCTGTATCTTTGAGCTGATACAGTGTAGCACCGTATACGGCAAAATCTTGGATGAATCGACTGTAGTAGTTCAACGCACCCAAGAA
GGATTGCATTCCTTTCTTGGATCTCGGGAACGAGAGTTCGGTAATCGCAGCTAGCTTCTTCGGATCTGCTTGGATGCCGGCAGGTGACACCGCATGCGAC
AGAAAGTCCACTTTCGACTGAACGAAGATGCTTTTCGTGAAACTGACGCTGATTCGACACTCGGCAAACCGACTTAGTAGACGGTCCAATGTCGCCAGAC
AGTCGTCAAACGTTGCTCCGCCGAAGCAGATGTCATCCACGAAAGATCGCCGATCAAACACCGGGACCAATACAGACTCGTCGGGTTCACCGTTCGAAAA
CATGTCAGCTATTGGGCTGTTCACGAGTCGTGCCACTGGGTCCATGGTTGACGAGGCTTCGTGGTCAGCGTCAAACTTTGTCCGAGGGCTCGGTTCAGGT
GCTGACAGCTTCAGTGACTCTTCGTTGTTGGTTCCTCGTAACAGCGTGGCCTGTTCCTCGGCTGCATGCATCAGTTTCGCGTAATGATTCCACCCACCTT
TTGGTTGGACAAATCCCCACAACGCGTTGTCTATCATTCGTTGGTAGATCATAGGCGCGTTCTTGAGGCCGAATGGCATTCGAAGCCATTCAAAGTGCCC
CAGTGCACAGACAAATGCTGAGATCTTTCGCGCTCGATGAGTCATCATTATCGCCCAGAATCCGCTGGCCGCATCGAGCGAGCAGAACCATAGGTAGCTC
TCTAGACCCGTCAGCAGATCATCGACGAGTGGCATCGCGTATTCCAAGATCGTTGTGACGGCGTTCACCATCTTGTAATCAATGCACAGCCGAATATCCA
CGCCGTTCTTTTTCAGCACTATCACAATTGGCGACGCCCACGGGCTATCCGAGAACGACACCAATCCAGCTTTGAGCAGCCCTTTCAGAAGCTCATATAG
CTTTGGCATGTGTCGAAGCGCCACTCGTCGGGCACGCTGTTTGATAGGAGCGTGCTCCTTGACATCAATATCGCAAACCACTCCATAAGCTGGTGGAGGA
AGCGCGTTACCACTCGAAATCATGATTTGCTCGTGTTTCTTGAGCACATTGATTAGTCGCTTCTGTTGCCCACCCTTGAACTCGACGTTTTGTACATTTG
GCGCCGAATAGTCCAGTATCGTGACCGAGGTCTCGGTCAGGTCCGGAAGGAAGGCAAGTTCTTGCGCATAGTCTTCAAGTTCAATGTGGTTGGCTTGGTG
TTCAGCCGAGTCCCTTGCTTCATCGACGTTCATGGTTTCATGTCCTTCGGTGTTTAGAACCCTCATTACCGCCATGAATGTCTTCTCGAGCACCGTCGCC
GGGTTCTTGTCTATTTTGTTCCCCTTGGGCGGCGGTTCCTCTTTATTGACTTCGCCAACTGCGGATTCTCTGATGTTGAACGATGTCTTGGTGGTCACCC
CTGGTGGTACGTCTCCGCTAACCGTGATCTTGGCAGACGGTGCGATCGGTATAGATTCTGGATCATTGCCCACTGGCAAGCCATCCGTTTCGTTGGCCGA
TATCTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCGGGTGGCCGGCTTCGCACT
CCTCGGGGTGGTGTATAATCGACTTTCTCCACTGCCGAAGGTTGTTTGGCGAGCCATTCTTGGTACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCC
GTGATTCAGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACAT
CACAAAGGGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGC
ACCAAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTA
AAAGCTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAG
TTGTACAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCAC
ACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCC
GTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCG
TGTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTTACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCTGGTAGCAATCTC
ACCGTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCACTCGAGACCCAGGCTTCGCACTCACTCTACCCGCTTTCTTCATCTTCACTCACAT
CGCCTCCACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCTATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACATACGC
GTAGATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAA
ATACGAGGGTCTGGAGCTCGGGCGAGAGGTCTTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATG
CACTTGTTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGT
CGGTCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAG
CAGTTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGA
AAAGTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTC
AACGTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAG
GATCGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCC
ACGATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCA
CACGTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGT
AATCACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAATCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATT
GAGCAGCTGCCAGTCACGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCATCACTCATTA
GGCGGGGTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTAGCGGAGTCCGAGGTACGGCTTGATCTGAG
CGAGGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTAGCATTCAAACTTTCCATATCGCTTGCTTCACGCATCTGGCGCGCAAATTCAGCAGCTAAGTT
GTCACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCAGATCCTCGTTTC
GAGTTCCGCGCTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGGAAGTACGGGG
AACGCTCGGCCGACGTGGCGAATGCTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTACATGACGCTTGGGTGTTTACGGTAATGGTATCATCGATGG
GTCGACAGTTTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCG
GCTCCAGCGGCCGATGGTGACCAGTCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCATCGCAGTCAGCAGGGAGACCGTATCCTCCG
CGACTTGACGAGTACTCGTTGAGTTCACTGGCCACGCGATTTCGCTGCTAATGTCCGCCCAGACAGCTTGGCGGACAGGTCTCGGCGCAAACATCGGTAT
CCAAGCGCTTTCTGTCCACATCAGTTCGAGGCATCGGCCGAGGACCTTGTTAGCGATTGGAGTATCTCCGTTGATCGGTGGGCGATTGCCTCGCGGCATC
GCCGAGTTCACGTCCGTTCTCGCGGACATCCTCTCTTCATCATCTTCATCATCATCATATGCTGGTTCGGGTCCTGCGACCGCGTCCAGCTCATCCGCGA
GATTCCTCGTTATCGACCGCAGCCCTCCGCTGTGCCTCGCCGTCAATCTCGCGTCCTCCGGGAAATCGGGCGTCACCATTGCTGGTTCTCCCGCCTTCTC
CTCCAGGTCATCATAGGCTTCAACATCTTCACCGTTGGTGTCGAGATCACCCGCTGAGTCTTCGAAGCTGACCGAGCGCTCGGCAATTCCTGCCATGCGC
GGAGTCACCGATGTTGAACTCGAAAGCTCGTTACGGCCGCCGCTGGACTACATCGGGGTAGCTGGTACCGCTGTTGATCCTTTCACCATTTTCTTCTTCT
TCCACACTTGTTTTTTGCTCGTACTTTGATTGTCTGTAAACAAGTCACAACACACAGAAGGTCACACCAATCCCGGATCGCGGTACTAGAACGTACTGTC
GTGTAGGAACACGCCAGAATTATGTCTGCTAGTACTCCCACCCACAACACACACCTCGCCCTTGAAGACGAGGTGAATATCGGGCGAAGTCTCGACCTGA
AGGCCTTGATTCAGCCCTAGCACCGGGTTGGTTAATGACCCTGCGCACTCCGACTTGTCGGTAGGACAACCAATCAATACAACAGCACTAGCCACGAGCA
CAGGCTAGTCTGCAACACACACTAAGTCAAACCTCGCTGGCCCTCAGAAGGAAGGGTCCAGGACTTTTCAGCCGGTAAGCGAGGGGGGCCGGAGCAAAGC
TCCGGTAGGTAGATAGATAGGAGGCTTCTGTAGCACTCCTAGGTCGAACGAGCTCTCTCGTTCTCTGCAACACGCAGCAAATCAATCACACAATCTCTAC
TTCTTGGACTTGCCGGGCGGATGAACACTTGAGTTATCAGCTCACGAGTCCACCGGCAGGCATAATCCTGGCGATCAAGCGGGACCAGACACTACGGACA
CTTACCGTAGCCGGACTTGACTCTTGTGCGATCGGGAGGAAAATCTGCTCTGTTTGTTGCGCCCTGCGGGCGCTTATCGCTATACTATGGTTTCCTATAT
CTCAATACAAATATCTAGTGTGAACTCGTCCGTTGGGAAACTCCTGGATTCCTGACGACTGCTCAGCGAGGTCTCAGGAGGCGCATCCGGCATATCTTCC
GGATGCGACTTCTCTTCAAAGGGCACGACTCGGATATCTTCCCTGACATGACTCCTCGTCAGGCCGTAGTGTGCCGTACATCACCTCGCTCTTGTGCCTT
GTCATTCTGCCGCGGGTCTTCTAGGCCAATCAACGCCCTGTCGCACACTTCCCCCAACGGGATTCTGACGACCAGACCTCGAAAGCAACGGCGGCCACGG
CGACGGCAGCTCCGGTCAATTCACTACACCACACCGCCTTCTCTCGTTTTAAGCAATGCTTATCTAGAGTCTTTCCTTGCTTCAATAAGATCAACTCAGT
AGGCACACGCAGGTGTGGATGCTTTTCGAAGAGCCATAGTTTTACATTTCTATGATATGATGTCGCAGTGTTGCGAGCAAGCTTACCTTTTTTACCTTCA
TTTGTAGCGAGATAGAAGTCGAACCAGTCCATTGTTACCGCTAAACGTTTACCGGAGGTGTCAAGGAGAAAGCTAGCATGGAGAAACTCTACGCTAACAT
CCTCTTCCTCCAGCATCCGCTCGAAAGCTGCAATCGCGGTGGTACGCGCTTTCTGAGTGTTCGTAGGGACGAACGCTGTTAGACTCATGGCTCCTTTTCT
TCTTTTTCGCTACTGTTAGAAATGCTTGTTAAAAGAACTATATGTGCGTCGACTAATCCGTACAAGCGTCGAATAGCTCGTACACGTGTCCAGTAACCCG
TACAAGTGTCGAATAAACCGTATAAGTGTCGAGTTTTCCGTATACTGACTGTCCTGTCAACATGTTCCTACTCTAGGACTGCACCTAATCGTATGAATGG
CTAGAATATTTGCAAAATATATTTTACCTTGGTATTCGCATGTAGATATTCATATTTTGGCTGTACTTCCGACAAATATTTGTCGGAAAGTGTCGGAATG
TAAACCCTAACCCTAATACTTTTAACTGGACAAAATAGTGGAATAACGTTATGGAATTGGTCAAAATAAGGATGAGTAACAATCCTGCCTTGTTATCTGT
CGGAAAGACGCGTATATTCATCCATATCGTGGAGGTCGGCTCTCGTGAGGTAGTGTTGGCCGCGCTGACGATCATGCCTCTCTCTGATCTTCGGCGGTGA
TTGTAAGCATCAGAATGAGCACAATGCACTCGCCGTTGGCCTCGTAGCTCATATCATAGTAGATGCGGAACAGAGTGCTGCGGGTGGGCACGTACTTTTC
TAAATCTGTGCGCACCAGCTAAACCTATGTTTTGGCGTACAGAATAGCTGCGGGAATCGCTCCAGTATTGACATATTGTGTGTCCACTCTTACTGACAGT
CAGGTATTGCGCGCTCCAGTCGTTAATGGTCCAACCTTTGCAAATTTGCCGGGAATATATACAGAGGAATACTTCTGCACGCTCTGTACTTTTGGATCAT
CTCGTTTTTGCTCAAAAGAAGCTATACAGTCAATCGAGGAACTAAAGTTCTCTAATGTGCTGTGTGGTGTTCCCGCAGCGTAGCGACACCAATCAACCCA
TAGTTTGAATCCCTGGCTGCACTGAGTTCCCCGACAAACTGTATAGCACCAATGCCCGTGACCCCACATCTGTTTTTCTACCCTGATTCAGCCCAGGTGT
TACTATTTTAATAGTAATATTTCAAAATGGAAATCAAGGCAGCAGCAAAGCAATCTTGTACTTTCGATGTCGCCGAGACGCTCTACAAACAACCGGCTGG
ATCCGAGCCTCGAACTCCGTGGGAAGTGTCCAAGGTGCGTTGCTGTTCCAGGTAGTACAGTACCAGACTCTGGTGCCTGTACCTCCGCCGTCGGAACCCT
CTCTGCAGCCGTAGTTTGCTGCAACAAGCCGGATTCTGGGCGGCTTCTTAACATGACCAACACCAGGCCGCACTCGCTTACGACTCGTACGTTACGAGAT
GGTCAGCACTTTATTTTTGAAGCGTATTTGCTTCGTCCACTTGTAGTCACAGACTGGGCTTTGAGTTTCAGTTCGAATCTCGGCGATCTCGATTTTGTGT
TGATATGCAGCTGGTCAAAGTTACCACGAAGAAGTGTGCTAGTATTTCTGTAACCAACAGGCTCACCTAAAAATACATGATTGTTATCTTGCATCACGGA
AACAATTGTGGCAACAACAAAAAAGTGCTATCTTTTTCATGCCCACCTTTCGGAGATATACTAGTACGAGACTACGGAAAGCTTGGCCCTCGGAAGCTAT
CCTGCTATGGACACGCGGCAAAGCGCTTAAAAAATGGTCCGTGTCGACACATTCGCATGTGTTTTTTTATGGCTAATTAGCCAGTTTGTGCCGACGGCGA
CGATATTGCATCAAGGAGCAAATCTTTTCATCAAGCATTTTTCTGTTCGACTTTACCGGCGGGGTAAATGACGACGCAAGATCGCAATCACACGCATGCT
GCATGTATTAATACATGGCATATTATAATAGTGCTTCTCTCTCTCTGCATGTATTGAGAATGTGTCAATCTTGCTCGTACATGTAGCCGAAACAATGTAA
AAGCATATAGCTCATACTTGTATCTACTTTAATGCACGGCCACCGTTGCCCTTATTTTTAATCGCCACTGCAGTATTTTCAATCTGTGGACCATCAAAAC
TCCGACGACTTATGTGCCGACGGCGGTCATCGGAAAACGCAGTGATGAATGGACACGGTGTCCATCATACCGAGTTCCGCTGTGACAGACACGATTCTAC
AAGCAGATTTGCTTGTCTGATCTTTCGCCGGAGGAGTCCTCCTCCGGGAGGACCTATGATGAAAGCTCCATTGAATGGATACCACTTCGCACGGGTCGTT
GTGCGCTGTTTCATTTCATTCACCTCACAACTCTTTTCGCCTTCTCGGTCTCATGTGGCACTCCACTTTGCTCCTCATCCTCTTTGCGTGCGTCTGCGCG
GCGCAGACTTCCACGGAGTCTGCCAGACTCTTGAGAGGTACTGTTCTAGACTCGTCGTCGAGTGACAGCGACCTGGATTCGGCCAGCGGTAGTGACTTGG
ATTCGACAAGCGACAGCGATGTGGACTCTTATAGCGGCAGCACAAGCGACATCATCAACGTCTGCCCAGTTGTCGTCAATTTCTCGGAAGAGCAAGATGA
CCTCTCCGATGAAGAACTCAAGGCCAACGCCGCTGACGCAGCCATGTCTGCCTACCTCCTGAGTCACCCTAACAATACCCTGTGGGACTACTTCAAGATC
GAGAGGAAGCAGAAGAGGGATATGAACAGCAAGCTGCCGTGGAAGGATCGGTTGAAGAATGCGATCAAGGACGTCGTCGACTTCACGGCTGACACGCTCA
TCGGCATCGCGAAGACCATCGCCAGTGCGATCGAATGGATCATCAACACCATCCGCGACCCGCTCGTTGGTATCAAGCAGATCACTAGTTTCTTCAAGGA
GTTCGGCAAGAACATCAAGTCACTCTGGGGGCTGATGAAGGAAGACCCGAAAGAGACGGCCGAGAATATGGGCGGCGGTTTGCTGCTGCACATTACCCAC
CACCCCGCCGAGTTCACTGCCGAGACCGTGCTTATGGTCGGTGCCGGGTTTGCAGCGATCCACGGTCTCATGCACGGCGTGGAGGCCGTCTTCGGTACGA
TGAGCAACGTCATCTCCAAGGTGCTGCTGTCCGTGTTGATGTTCATCCACGCTATCGATGACCCGATCTACATCGTCACTCCCCTCGTCACCTCCATTGT
CAACACGGCCGACACTATTGCTGATGGTGGTAACAACTCCACTACTGATGCCATCACACTCACGCCGGATGCAATTCAGCCGCTGGAGGCTTGTATGATT
CCTGAGGAGTACCGCCCTGTCTTCTCGTCGCGCGATCTGTGTCTGAGCAGGACAACGGAAATTCGTCAGCTTCTCTTCGGAACCACCAAGCGCTCGATCA
AGATGACGCAACAAGAGCAGGTCGCTGCCTACAACCGTTTCCACGACTTCGTGTGCTGCTACCTGCAGGATCAGTCATTTGAGGTGAACGCTCCGAAGGT
TGACTCGACCGCCTTCGAGGCTGACCTCGTCGCCACGCCCGTGAAGATGACAAACTGCTCGCAACTTCTAGGTGAATACAGCGACGCAACCGTGTGGACG
TCGTCTGCTAGTCTCGCAGGCTCCGCGAGCCTTGTCGACAACACCGAGGCATAATAAGTTTCCTTGCTCGCCACCTTTATCCATCACAATAAAATGGTGA
TTAAAAAAACATTTGTAATTCCTGTCAATCGTAGAAAATATTGTGTTATGAAGAAACCTCGAAACGAGAACGATCTGGGCGCTCGTCTAAAGCGGCTGCC
ACTTCCTCCCAGCCTCGAGCACCCCAATGTCATGCAACTAGTCGCAGAATTCGCCATGTTGCCCGAAGAAGCGATGAAGGAGGCCGCCAGGACCAACCAG
ATCGAATGGCTAACAAGTATTTTAACTCGAATTTTCGGATAAAATGGACAAAACGGCCATAATACTCACTGAAATTGGCGCCATTTTCCAACGCTAAAAT
ATGGGCACGACCACAACCCACTCTGCTGCAATGACCTTGGAATGGGCATTTGACGCTTTTGTGGGTGGCATATGAGTGATCGGTTCGGGGTGGCTCTGGA
CAACGGACAACACCCGGTTGTTGATACAATTTGCAAGAATTTGCCGTATTCGAAAACATTGCGTTGGGGGGGGGGGGCGGAATTCGACAAATTGGATGTG
GTCGATCTCGACCAGACTTTGATGTTCGCAAGTCGAGAAAAGGTTTGTATGAGGCAACGTTGATCGCGGCGCACCACGGACATTTAGGGATTGTGAAGTT
CTTAAACGAGAAGTGTGAAGAGGAACTATTTGGAGACGAAGATAAAGGCAGTGAGATGGAAGAAGATGATGACGATGATGACGATGATGACGATGATGAC
GATGATGTTTTTCCCGATAATGAATGCCCGCTTGCCACTGCAATTAAGCAAGGTCGGCTTGACGTCGCCAAATATTTGTATACTAACCACGGGTACAAAC
CCTCGTCGCTGGAGATGGCACGGCCAGCAGTGGTCCGTTGGAATTCGTCAAAACAAGTTATGACGACGGCACATATGACGAGATTGACCCCAGCGCGTTT
GAGTTTGCTGCTGGCGGTGGCCAACTTGAGGTTATGAAATTTTTCCAGTCAAAGGAAGTTTTTGAGGCTTCTTCTCTCGGCGACGCGCTTGTGATAGCTG
CGGTATTCAACAAAATGGAAGCCACCAATTTCTTGTACGCGAGTGAAGAAGTCACACTTCTCCCTCTGCGCTTGATAACGCGGTGAAAGAAGCAGCCAGT
TCAGGTTGCCTGGAAGTGCTGAAGTATTTGAATAACAAAGAAAACTAACTCTCAAGCTGACCAAGGAGGCATTTGCCAGGATTGTTACAAGCACAGGGTG
AAGCATTAGATTTTATGATTGAGCGTTTATGCGAAAATTTGACTATGAAACGTCAGTTTACTGGGCAGCAGAGCACGGCAAGCGAAGCTGATTTATTTCT
ATCATCACGAAAACGCTGGTTTGTGGGATTTCTATCTTATAGCTACTTCGCATGGATACCGGTATCTCGACATCGTCAAGTTTCTGAATGAGCAATTTGG
TAACTATATCGATTAGGTGGTGTGACAGAGGGGGATGTCCACTCACAAATGCGATTGAAGGTGGCATGGTGGAAATTGACAAGTACCTGTATCACAACAA
CGGATACAAGGCGACTTCGTTTAGATAGGCATTTTCAGCTGTGGCTTCGTGCAGTCGACTAGACCTCGTCGAGCTATTTTGCGCTGATGCAAGGTGCAGC
GCTGCTTTGATTAACAAGGGGTTTAAACTTGCGGCGGGCTGGCCATCATGAAGCTGTTTCAGTCCAAAGAAGGCTTCGTTCCGTCTGAGCTCGACAAAGC
ATTCATAAAGGCAGCTAGAAGTAGTCAAGTGGATATTCTCGAGCAGTTTTAAGGATATCAACCTTCGGCATCATTATTTGATGAAGAAACCATGATTGCC
GCGGGAGGTAGCGGCCATCTCAAAGTGGTACAGTTTCTGGATAGCAAGGGGATACTATCTGACGACCCAGCGGTTGAAGTCTTCACGAGCGCAGCTGAAG
ACGAGAGGCTGAAGCATGGGGAAATCGATGACCAAGCTGGTGGTTTGACCTTCTTGTACTCCAAACGATGCATCAGTTCGGACATGATTGATTATTCCAA
TCTTCCCTGAATCGGCTGGCTGCTGCTGCGTCGAAGGTTTGGCATTCCTGTTCTCCACAGGTTCGATTCCTTCTGATGTGATAGATGAAGCGTTTCAAGA
TGCGGCGTCGGGTAACTGCGCCGCTGTTGTTTCCTTTACAAAACCGGAGAGGTATCTCCGAAAATGGTCGACGAGGTTTTTCTTGATGTTGCACAACAAG
AGGACATCTCTAGGTTGTGGAGTGCCTGTACAATAGCGAATGTACTTCACAGAAACTACTGAGTAAGGCGTTACGTGTACCCCCCCCCCACCCAGCCTGG
TTATTTCGTAGTCGTAAGAAGACTCCTGCTGAATGAAGCAGCCGAGTTGGTTGGGAGAATGCAGATATAATTTCGATACCCACGCTAATAAACCTTTCAA
TCGGTTTGTGGATTGCATACTACGTAGTGGTTGCAGTGGCAAATACTGTCAAGTCACCAGCTAGAGCGAATGACCGCCAGCATCATGTCTCCCCTGTATC
CGAGAGCCTTCGCCTCTTGGCCAGGGGGCAAAATGAACACTTTGTACCCTTGAGATTCCATTTCCAAGGCCACTCCAGCACGCGACTGGTTCTGGCGGCC
TCTAATGAGGTATTCGCGAAAGCGTCCATACTCGGTGGCATCTTCCACGGTGGCCGGGATCAGCTCAACCACGGCACGCTTGATGCTGGGTCGGTCAAAT
TTCAAGAACTCGTGGAACGTGTGCAACCGAGCCAGTTGCACCACGTTCATGACCGGTGGTCTACACAAGTTTGTTGTTCCAAGACACAACCACGTCAACC
TTTGATGTTATGTAGGGGCTACAGCACGCACAACGTACAGTATGGTCTGTAAGGTCGTGAGGGGAGCAGCTTGGCAGTAACACTTGTGCACTCCACTTCT
CCTTAGTTGGATCACCTGGTGCTTTCTTGGCTAGCAAAGCAAAACACACAAAAGTCCATACAACATAACGAAATAAACACTTGGCATTATCGACTGCCGC
TTACCACCCTTGCTGCCATGCCTCTCGCCGTCAACAGCTTCAAGGACTGCTGGAGTCGCTAGAATCACTTGAAGGAAGCCAAGTCGGCAGATTCAAAACT
GAGTCGTCCTCTCTTCTTCACTCTCCTTTTCAACGCATCTGCGGTACCTTCCGGGAAACCCGCGAGCGTTGACCCCAGACGTCAATCAAGCCACGTTGAA
GTGACTCTGGAATAAATGTGTGTGGGCCACATTTGGCATGCCTATCAAAAACTGAGCAGTACACACATCACTTCAAGTCGTCATTAATCACCACGTCTCC
ACCCCTCATTCCTCAATCCTCTCTCTCGGTAACAAGCAATTTCCAGTCATGGTTTCTATCGGCACTCGCTCCCCAGTCTACGGTCGTCATGGGATGGTGG
CGTCTTCGCAGCCCCTGGCCTCCGAAATCGGATTGCGGGTTCTCAAACAGGGCGGGAACGCCGTGGACGCGGCCATTGCAATTGCGGCCGCGCTCAACGT
CACGGAGCCGTGCTCTACCGGTGTGGGGGGCGACTGCTTCCTGCTCTTCTTCGACGCCAAGACTCAGCAGGTGCGCGGTCTCAATGGCAGCGGCCGCAGT
CCTGCAGGTCTCACGGCGGACCAGGCCATCCAGGATCTAGGACAGGACGCCAAAGTGATCCCCAGTGGCCACGGCCATGCGGTGACGGTACCCGGTACCG
TGGCAGGATGGGTGGACGCTATTGATGCTTGGGGGGCGTTGGGTATGGGGCAGGTGCTGGCCCCCGCCATTGACTTGGCACGTGAAGGGTTCCCCGTGAG
TCCCTTGACGGCTGCGAGCTGGGAGCGAGGAAAGACCCAATTGCTGCGTGGTCCTAATGCTGCAGAGCTGCTGAATGCACACGGAGAAGCTCCGAAAGCG
GGGGAGATTTTCAAGAATGAGAATTTGGCGAGATGTCTTGAAGAGGTCGTGGAGAAGGGCAAGAAGGCGTTTTACGAGGACGGACGCATCGCTCAGGCGA
TCGTGGACATGGTGAAGGAGAAGGGGGGCGTGATGACAGTTGAGGATCTGAAGAGCCACAAGTCGACGTTTGTGACGCCGATCAGCACGAGGTTCCAAGG
AGTGGACGTCCATGAGATCCCGCCCAATGGACAGGGTATCACTGCGCTGCTGGCGCTGAATGTGCTTTCGCAGCTGACGAAGGACGGAGACTTGCCGCCA
CAGGGGAGTGCTGAGGAGGTGCATTTGCAGATTGAAGCGCTCCGACTTGCGTTCGCAGACGCCAAGTGGTTCGTGAGCGATATGGAGCACGACACGTCGC
TGCCTGTCGAGGAGCTGCTGAGCGACAGTTATGCGAAGAAGCGGGCGGCGCTGGTGGACCGGACGAAGGCGGCGATCGACCCGAAGCACGGCAGTCCCGA
GCTCAGTTGTGACACCGTGAGCTTCCAGGTTGTTGATGGCCAAGGCAACGCTGTCTCGATGGTCAACAGCAACTACGAAGGATTCGGCACGGGCCTCGTA
CCCAAAAACTGCGGCTTTACGCTGCAGAACCGCGGCTGCAACTTTGAGCTGCACGGCGCTGAGGTGGGGCACCCCAACGCGCTGGCTCCGAGCAAGCGAC
CGTACCACACGATCATTCCTGGGCTCTCGACCTTCGCCGACTCTGGCGAGTTGCACTCGAGCTTCACTGTCATGGGCGGCTTCATGCAGCCCCAAGGCCA
CGTCCAGATCCTGAGTCACCTGCTTCTGCACGGAATGAGCCCCCAGGAGGCTCTGGACGCTCCACGTTTTAGCATCGATGTGGACCGCCCGACCAAGCCC
GGAAGGAGCGATGGCGGCAGCTCAGTCCTGGTGGAGACGGATTTGGGCGCCGGTGTGATCGCAGCTCTTCGCGACCAGTTTGGCCACAGCATTCAAGAAG
TGGAGGGGCTGAAGCGATCGACCTTCGGTCGCGGGCAAATTATCCTGCGGGACCCGAAGACTGGAGTGCTCTGTGCTGGCTCGGATGGCCGCGCTGATGG
TTGTGCTATGGGCTGGTAAGCTGATGAGATTGTGGGAAGTGCCTTCAACAACGCACGCTAAAGAAAGACAATGGCATTTATTCGTGCATGAACGCGATGG
AACTCTTTTCATTCGCTCCGAGTAGTTATTTGTGCACAAGCTGAAGGGCTCGCATGCTTCTTGGTCGAGGCTCGCTGGTTTCTGTCGTCTTCAGCAGGAT
AAATCGCTCAAATGATAGTTGCGAGACTGCTGGACGGGTACGACGCAGCCGCAAGCAAAGGAGCAGATGACGACGAAGTTGTACAGTCTTCGAAAGCCTC
AACCACAGCGAATTCTTCGTCCACTGAGTCAGCGACAGCAGCACCGCGACCGCCATTGCCTCGAGTTTCTCCGAGTTCGTACACATCGCATGCAATGATG
CTGCAACTGCAAGAATACCGCTCTCGGGTTCGCCATGCGTTCGAGTCAACATATCGTCACCCACTTGCCGTCGCTGCAGCTACCCCTGGATCTCCTCCTA
AACGTGGCGCTCATAGCGGAAATTACTGTCGAACGCGCGTCCTCGAGTCCTCCAGGCAGCTTTTTGCGCCTCAAGCTCGTAGTGGGGCACCTCCAATTCC
AATGTCGCCGTGTTCTCCTTCACGCACAGCAGTCAAAGGTGGCGGTGTGGCATTCCACCGCTCGACAACTTCGCCCCGAACAGCAGTACAGTCACCTCTC
TTCGCACTTGGACCAGGACAATACGACGTCGTGCCTCGGCGACCTGCCACTACTGGTAGCGTCAAATTCAGTCCGGCTGACCGCTTTCGAGAGCACGCAG
GTGGTGGCAACAGTGATCCCCACGCACCAGGACCAGGCCAATACCTTCCTGATGATCGAGTTACTACCAGAAGATCAGCTCGAGTCGTATTTTCCCAGCT
TCCTAGGCAGACAGAGACAACGGAGCCACCTCGAGCTTCCATCACAGCACCTCCAGCTACAGCGGACGTTGTATCTAGCTATTACTACGTCCCATCCAGC
GGCTTCGCAGCACCCGGGGATAGTGCCGCTAAGACTGGAGGTGGAATTCCTAACTGGAGTCGGACTGCTAGATTTCCAGGACAGAGGCGTGAGATTTTTC
ACCAAAGCGGTACCCAACCATCCCCTGCAATCGATTACATTGCACGCAACAAGGCGAGGATTGAGAGTATGTCTGCGGAGCAGCGCCAGCGGCGGCGGAA
CCAACAACCTGCGACCAAGACACAGCACAAGCCTAAAGACACAGGAAAAGACACTCGACAGCGTTTCTCGGTAAGACGCCGCAATTCGCTTTTCTTCCAC
GATCCAGCTCGAAGTCGGAGGCGACGAAGTTCCACTGGCTCAATGAAGTGCGACGTAAAGGAACTCGAGGCGAGGGAGACTGTCTCACAAGCGTGGGGTA
CACTGGTTGTGCTTTCCGTCGCTCAAACCAAATTTGCGAGGCTACTCGTGGTAGCTGCCGTACTACATCGGCTTCGTCGTGCCCAGGAAATGAGCTACAA
ACGTATTACTTTCGAGTCTTGGACCCATGTGCGAGATCGAGATGCAATGCGCTCTCTAGCGGCAGCGCTGATCGCACGCAGTACATTTCGCTTTCGATTA
CACCGGCGAGTGGAGCGCAAGACTCATGCTGCAAACCTGCTGCGCATCTTTCTATCTGGGCTTTCATTTGACGTTCGATTCGCAATGGCCGTCCGTCGCG
TTCAACGCCGCATTATTCTGCTCCAGCGTTGGTGGCGTCGATCTCGACTCGTCGTTCGTGCTCGCGAGCAATGTTTGGTCTACAAATGGCTAGTGGTCGA
GAAGCGACTGCGCACGGAACACATAGCGCAAATGCCGCACTTGCAACGCGTTTTCCAGCCTCCAGCGGCCTCTGTCACTCCTAGTTCCTCGAATTCCTCG
ACGAAACGAAGAGCTTCGATCGTCGCTGGAGCACAAGCCGTGGCTGTGGAGGCTCAATTGCCGCTGCACAAGCTGCTGAATTTACCCGAGCAAAAGCGCT
GGTTCACGGCACGATTTGTCCTTAGTCCCGATGGAATTTTACGTGGTTATTCAACCCCCGGCCCGGATGCCGAGTCGGGCGCCAAGGCTGAAGATGTCCT
CGAGAGTGCTTTTGGAGAGCGCATAGTGGTCGAAGTGAAGCACTTTCGGTGTCATGCGCATGGCTTTGCAAATGTGCCATTGGGCTCGACACACGGAGGT
GGTGGAGACGATGAGGGAGGAAGCGACCGTCGGCCATACTTGATGGTGTTCAAGCCTGGCGCTAGTCGGTTCATTCTGATCACGGATATGAGGAGCCTTA
TCTTAGCGCCGCTGCTCGACTGGAAAGAGAAACTCGAGCGCGTTGCTGGATACCCCAATGGATCACCATTCCCAAGTGGTGGGTCCCAACGTGATATCGC
AGACATACTCGCGCAACCGGACGCCTCGACTGTAGATGATACCATTGATGAAGCTCCAGTGCCAGTCACTAGCTCACGCAGAGGGAGTGTGTCAGGATGC
GTGAATGGTGAACGAGCCCCCTTGACCTCAGGTCGTAGACGCAGCAGTCGTCAACACTTACGTCGAAGTAACGTGTTCCAGCCTATTGCCGAGGGTGAGA
TGTCGTACTACGTAGTGGATCTACTACGAGACTGTCCGCGGATCCCAGCACCAATCGTTTGGTCGGTACTGCGCGACAAACTGCGAGAAGAGCGCAAAAC
GTTCCGATCCGATATCTACCGCTTCAACTTGGAGATCGCTCGCTTTCAACAGCACGAGCGTGAACGACGTCAACTTGTCGTACTTGACAAGTTCAAGGAG
TTTTTCGTACGTCTGCAGCTTTTGTTTTGCTTTTCTCTCGTCGCTAACCGAAAGGATATGTTGAACAGACAATGGAGCGTCCTCACCATCCTCACTTCCG
AAGTCTCATTTCGAATCGCAAGATGGAAACTCTCGTGCGTCAGACCATCGAAATGATGAAAACAACGCAGCCATCCAACCCAAAATTCATGCTGCCGTGA
TATTTGTACATTTGTCGGTTTGATTCGCCAAAATCTAAAAAGAACCATTCCACAGAGAGACGGACACTAAAAAAAAAAATGGTGTCAAGGATAGCTGCGT
TGCACACTTCGAAGTATTTTATGATGGAAGCGCCACATCTGCCAGGTAGATAGTAATACATGTAAGCCTTGTACGAGCAGAGCAACGTTTTATTACGAAT
GCGTGCAAGGATACACGCCTACACGTACGAACCACGGCAGAAGAAGCTTTTTTTTAATGCGAGCCGATCACTGGCTTTGGCGCTGAGGATACGGTTGATT
ACGAATTGGATAGGGTGGAGTCCATCGACCCGGTTAGGAGTGATCATAAAGTAGGTACAGGGCTGAATACACGATTGCTATTGTCAACGATGCCTTAGCT
GCGCTCATCTGTCGTCAATCCTTGACTGACTTTTCAATCACTTTGCAATTTGATTTCAGTGGCCCAAGTTCCAAGATCGTGCAAGAAGGCCAGCAATGCG
CCGTTACTTCATTTTGCTGATAAGCTTATTAGTTGTTGCGTCTCTCCTATCAACTATCGGTGCTACGTCAGAGACTACATCTCTTGTGGCGCGTTCCGTC
ACTGGTGACCAAGTCGACGCCGTTGCCAAGAGGCTTTTGAGAGGAGAGGCTGCAGTAGACGAGGGAGATGATATCGAAAGGGGCGAAGAGAGAGGACTTG
TGCTTCCCGGCGTCGTCCAGAAACTCAAGTCGATTTTCCAGAACGCTAAGGCCAAGGTGTGGCAATTACGTGTGGAAATCAAGTTCCGGTCGCTACAGCT
TGAAAAGGGCTCTTTGTCCAGCTCGGAGATGAAGATGTGGGTTGACTCCGTGACCAATCTCTACAAAAATGACCCCGAGAAGTCTACGAAAGCAATGCTG
ACTACTTTGACAAGACATTACGACGAAATTACTCTGATGAGGTGGGCCCACACGGCTATGGACTCGTCAGACATGGGAATCCTTGGTCACAAGCTGCAGT
CAGCACAGTTTACTAAATTGATGTACAGAGGATACGATGCGCTTGGCCTCGCGAAAAGGCTGAGAACAACTGCTGGGGGTGATAACCAGCAAGACAAGCT
GATTGTGCAGGCGTTCGCTGCCTTCGTTAAGCAACGTAGGCAATCGGCTTGATGAACACGACTTCTGCAGTGCTTATACTAGGTTAGATGCACACTTCTC
AAGTACGAAGCTTGCAACGCACGCGTAGTGTAGGCTTTGTTACTGTGAGTATTGGTCACGGTATCGAATTTTGTTTCTTGATGCCGTCGTCTTACGCGCG
TGAACACATGTAATCTTCCCATATTAATTCACTGCATTACGCGTGTTGCACTGACGTTTGCCTCGGCACACGGAGTTGGCGGAACGATGAGCGACTGTCG
CCCTAACTTGATGGTGCTCAAGTCTGGTGCTAGTCGATATGACGTAGCTCCACTACTCGACTGGAAAGAGAAACTACAACGTGTTGCTGGATACCCCAAC
GTAAGTATTAACCCTTTCGTGAACAAGCGTCTTGATAATAGTAATACTTAGACCATTACGCCGGCAATTTTTTTCCTTACCGTAATTTACCACCGAGAAC
ATTCCTGAAACCTTCCTTCGGGGACAGCAGCGATTTCAACGTTTCATCATTTGTTGGAAGTCTATGTGACACGCCTTCTTTTCCGCTTA