Description :
From Genome Similarity Track
Location :
Scaffold_786:2576- 4286
Transcript NameFunction/comments
Phymu_g11964hypothetical protein

Sequence
1710 bases(100 bases per row)
tgctccagctcaacGTACACGGATGCTGGGAAGTTATAGCAGCTTTCCCCGCTTTGGTACACGTGGTTTCCACTGAGCAGTGGTCGCTTGATCGACTGGA
GAGTGACAATTGCTCGTAAGAGCTGGCGACTGGAGAAACCCGAGCCAGCATCTTTTGCTTCGCTAACTGGATAATGAAGAGGTCGAACGTCAATTGCAAG
CGCTTCGGTTTGTTGCTATCTCTGGATCGGATCAGGTCCTCCAGCTCTGATAACGTTGGAAAGGCATTACAAGCGATAAAAAGGTAAGAATATCGCACAA
AAATGTGATCAAAGTTTAGATATTGTTTCCACAATTATGTGGCGGTGCCATGTAGCCACGCGAACTCGAAGCTGTAGTCGGAAGCTATTGCACAAGTTGT
CAGAGTGGGTAACAATTTGTAAAATATCAAGAAAGAATGAAATCTTaccaaaatgctgcaacGTAGCTTGTACATTGTAGAAGACCCACAATACCAGCTT
CGTCTGTACCTGTTCTCCCTGTTTTTCGAGGACAAAAGCCAGTTGTCGCAGTCCTGAAATTCGCAGTCGATGCcacaaaacaaaaaagagGATGACGAGA
GAAACGAGCTGCAAAAAGCAGTACAGCGTCACGTTCGCCAGCGTGTCCCACAGCTTTTCGTCGTCCATAGTGACGATCTGAGAATAATACACGCGGTTCG
GAAGGTGATACATCACGATCAAGTTCGCCGCTAGTAGTATAACACAGAAGTTAGGTTAGCTATTCAGCAAACAAATTATTGTCAATATTGCAACTTACAG
AAAATCATGGGGACGATGACCTCCACGTAGTTGATCAAGATGACAAATTCCGTAATATACAGCACTTTGCGGACATTCAGAGCGtagtccagctccagtg
tcgtGACGTCTGCCTTGCCTGATGGGAAAATCTGGCGCAAACTGAACTTTGGCTTTATCTTCTTGAGCGGAGTTTGTCTAGATAATTGTTTTTTTGCTGG
AACTTTGGCGTCGAACGGTAGAACTTGAGTTAACGACGGTCCAACGAATGTAGAAGCGAGTTGTTTGCGCTGCACAAAGTTGTGTCGTTCTAAAATGTCT
TGTGTGTAGCCTAGAATTGTGCCTTTTCGCACCGCATCGAGCGTTATTGTGATATTGTCGCCGCGGTGCTGCGcttgctcaagaagaacgcgatTCCGTA
CAATTTCCATCCGATAAATGACCTTCTCCACATCGTACACTGATGCGATCATCTGCACCCCGTCAATGGCGATCAGCCCCAGTGTCGTGTATATCGACGG
GGTATTTTGCATACAATACGACATGAAGAGCGAATTAAAAACCTCCACGTTCATGAGTACAACCTCGGGGATCTCGTCGTTCAAGTGCACCACAGTCCTC
GACATTAAATTACGCAAGATGATCTTGATGATAGGGAGTGAAAGAGCATACCAGGTCTTCGCATTGGCCGGTAAAGTCGTGAAAATGTAGAAATACGTAG
GATAAATTACCACGAGGCTTTCCTGGCAAACCCAAACTTTCAAGGAATTCATCACAAGGGGCCACAATTCAGGATCTGCCCTCGCTCTTCTAAGGAAAGA
GGCAAGTGGGAGAAGCAGGAACGCAACCCACGCCGGTGACACTGTGATTATCCCAAAAGGAAGCGGAAATCCAACCGCACGAGATAACGCATATAAGACG
CCCGTGGTTT