Description :
From Genome Similarity Track
Location :
Scaffold_806:2576- 3578
Transcript NameFunction/comments
g10649.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
AGAGCATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCG
TCCGGACCTGGCAGCTGCAGTGGGAGTGCTGAGCCAGTTTGCAGCGGACCCGTGCCCGACACACTGGCAGGCGCTCAAGAGGGTGTTCAGGTACATTCAA
GGCACCAAGACACACGGCATCGAATTTCAAGCAAGCTGCAACGATGGACTTCAAGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGA
GCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCGACGGAGGCCGAGTACAT
GGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTACGAGCTCGGCGAGATGGCAGGCGATGAAGCGGTCAAGATCTACGAGGAC
AACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACAAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACG
GTCAAGTGGTGCTGCAGTATGTTTCGACAACCGACATGTTGGCGGACATGATGACGAAGGCAATTCCTGCAACGCAGTTCAGTGTGCTTCGGACCAAGCT
CGGGATCCAAGGGGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTC
ACTCAGTGGGACCGCAATCATTCATGTGTTGACGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGA
CACGTGGGTACAAGATTGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAA
TC