Description :
From Genome Similarity Track
Location :
Scaffold_1:2575928- 2610259
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00661O-phosphoseryl-tRNA(Sec) selenium transferase
Phypa_INRA-310PPTG_00662eukaryotic translation initiation factor 3 subunit
Phypa_INRA-310PPTG_00663zinc-binding protein
Phypa_INRA-310PPTG_00664hypothetical protein
Phypa_INRA-310PPTG_00665kinesin-associated protein
Phypa_INRA-310PPTG_00666hypothetical protein
Phypa_INRA-310PPTG_00667ADP-ribosylation factor-like protein 2
Phypa_INRA-310PPTG_00668hypothetical protein
Phypa_INRA-310PPTG_00669charged multivesicular body protein 5
Phypa_INRA-310PPTG_00670ATP-binding cassette sub-family F member 2
Phypa_INRA-310PPTG_00671hypothetical protein
Phypa_INRA-310PPTG_00672hypothetical protein
Phypa_INRA-310PPTG_00673Cullin-associated NEDD8-dissociated protein
Phypa_INRA-310PPTG_00674hypothetical protein
Phypa_INRA-310PPTG_00675DEAD/DEAH box RNA helicase

Sequence
34331 bases(100 bases per row)
GAAAAATAATAGAACGACGGGATTGAATCTTAATGAATTCGACAAGTGCGGCGCTAGCGGAGCAGTTCGTGCCGGTCACGTATGTGCAACAAGGTCTCGA
TGCGCTCCGCTCGCGCGAGAAACAGGTGACGACTTTGCTCGCACAGCGTCGCCTTCCGGACAAAGGCTGGGACGATGCCAGCGTGGAGCTGCTGCTGCAA
ACGCTTTCGGCCATGGACAGCAACAACTTTCTGGGTAGCGCAGGCGCCGGCGAGCGCGAGGCACGCGTCTTCTCTCCATTAGTGGCGCGTCGTCATTTTC
ACTTGGCACATGGTATAGGTAGATCAGGCGACGTGGCGGCGGTACAGCCTAAAGCTGCCGGGTCGTCGCTCATGGTGCAGGTGGCTAACGCTCTAGCCAA
GGACGTGCTGCGTCTCGCAGGTATGCGGGCGGTACAAGCGGCGTTGGTACTGCCTGTGGCAACTGGTATGTCGCTTATGCTGGTGCTATTGCAGCTGAAA
GTGTCAAAACCCAATGCACGCTACGTCGTATGGCCTCGTATCGACCAAAAGTCCTGCTTCAAATCCATCTTGGCGGCCGGATTAACGCCGCTAATACTGG
CAAATACTTTGGTAAAGGAGGAAGATGAGAGTCCTAGCGGGTACTTGAAAACAGACTTGGTAGGGATGGCAGCACTGATGGATCAATACGGGAGTGATAG
CATTTTGGCTGTGATGAGCACCACAAGTTGCTTTGCGCCGAGGGCCTATGATAGCGTGAAGGAGATTGCTGAGCTTTGTCAAGAGCGAAACATTGGTAAG
AAGCGGGGTTGTCATGAATTTTGCTACCTTACTGGAAGTGACGAGGTGTTGCGGCTGTTATTGGTGAAGCCCATGTGATCAATAACGCTTATGGTGTCCA
GGCATCCAAGTGTGTTCATCAAGTAGAATTAGCTATGAGAACTGGGCGTGTGGACGCCGTGGTGCAGAGTCTCGACAAGAATTTCATGGTGCCTGTAGGC
GGAGCCATTGTTTGTTCGGCATCTCGTGATATTGTTGACCGCGTGGCAAAATACTACCCTGGTCGAGCCAGCGCTACACCTACTCTGGACTTCTTCATTA
CGATACTCCAAATGGTTTGTTGTAACAAGCACCAAAACCTCCTAATCTTGAAGTATCTAATAGTGATCACCTCGTTACATGCTAGGGGAAGAGTGGATAT
CGACGACTACTTGAAGAACGCAAGCAACTCGCAACTTACATGCGCGAGAAGCTGGACGCGCTTGCAATTGAGAAGGGTGAGCGTGTGCTGCATGTCTCCA
ACAACGAGGTAAGCATTCGGCAAGTGAAGGGGATTGATCCGCTGCTCATTCTCATCGTCTTACCCACCTCTCAGATCTCTTTTGCGCTGACTCTGGGGAG
TTTCTGCTCGGAAGTGATGGACAAGCAAGAAAGATCACGACGGCTGACGTTACTTGGCGCTATGCTCTTTTCACGTGGGGTGTCTGGTGCACGGTAAGCT
TGCAACGACTGTAGTAGCCGACAGCGTTACAGATCATCTGACTTTGAGTGCCTGCATTTTCAGAGTTGTGTCGTGTCTCGACCACAAAACGATTGCTGGA
CACGAGTTTCCATCCTTTGGAGCGCATTATGACGGATTTCCTGTGGCGTACGTTACCTTTGCCTGTGCGTTGGGCATGCGGCATGACGAAGTGGACTTAC
TCGTCACGAAACTACGGAAGACAATTCATGAGTGGCGAGCGAAACTGAGCAAACAATCACCTCCAGTCAAGAATCAAGTAGAACAGAGTTCGGCACTCGA
GAACAAGTAGACTGTCTATAAATCTGTTTCCTGATGTGCTATCTGTTTGTTTCCTATTGCTCCTTGCTTTTCCTGTAGACACCACAACTTCGCTGGGGCA
TGTTTAGTGCTTTTTTCCACTGTTCTTGGACTTGCGGTTTTTCTTCTTGGTCGCAGGCGGCGATCCAGCATCTTGTCCCGACTGGGTCTTGAATTCAAGC
TCACCGAGCAGTTCGTTGGCAATCGCATCAGCGGCTTCAGCAGCGTCCACTTCCCGACGGCCCTTTGCACCCTCGACGGCCTTCTCCGTGAACTTGGCCA
TGAACTTGGCCGACTCAATTACTCGTGGGTCCTCGTCTCCGAACGCCTCCTTCATGAGCGAGTACACCTTCTTCTCGTACATCAGAGCCTCACGGTAGCC
ACCAGCTAGACTGCACGCTAAAGCCATTTGGTGGAGAACGTTAGCCGCCTGGTTGCGGTCAAACTCACCACGACGAAGAGACTCGCGGTGGCACATGAGT
GCCAACGTAATCTGCCCCACATCCTGGCACATCATACCCATTTTGAAGTAGAGCGAGCTAATCTCAGGGAAGTGAGGGCCGCAGCAGAACTCCAGCAGGT
AAATCGCGCGGCGGATGTGCGGCACTGCCAGGTCCGTCTGGGCGTTCGCGTGTAAGAACAACGCCAAGTTCGCGTGCGCGTAAGCCGTGTCGTGGTAATC
GATACCCTGGAGCTGCGTGTACAGTGCCAACGCTCGTTGTTGCTGTGTAATAGCCCCGGCGACGTCACCAGCGTGGTAGAGCACAGTAGCGAGCGACGAG
CTGCAGAGTGCTGCATCCTCGTGGGCTGCACCACACACCTGGAAGAGCAGAGACGATGACTCTTGAAGGAACTCGTACGCATTCGACAGAGCGCCCTGGC
TCAAGTGCATGCGACCACGTTCGAGGAGCTGCTTCGCCTGAGCCAACGGGTGTGCAGGCAAGGAGGTCTTGACGACAGGCACGACACCAGTGATGTCATC
CAGGCTGATCGGCGACGATGACGAGAACTCGTAGTTACGGCTCACAACTCGCAGACCCAGACGCTGGCACAGACGTCGCAGCATGACCGATTTGTTGACA
CGGCCAGCAGGGAAGGCAGCATCCTCGCCACGAGATTCGTCACGGCCAGGACCCCACAGAGTCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTGTCAA
TGCGCGTCCACAGCGTATTGGCATCCAGTGAGGCCGTTGTGGTAGCATCGGTGCCATTGGCCTCGTCGGTCCTGTCCGCAGCAGCAGCCGAGATGGATCC
AAGAATGCCATTGAGGAGCTTCACAATTGCCGTTCCAGGGGCCGCACGAATCGAGTCGTTGGAGTTCAAGACATCAGCCAGGATGTGCTTCGAAACACGC
GCAATCATCTCCACCTCCAACATCTCCAGCAAGTACTTGGAAATACCGCTAATGGCCTCCAGCTTTTTGGCAAGCGAGGCCAAACGACCCAGGTAACGCA
TGTTGATACCGCAAGAGTGCATCAACTGCGTGAGAGCGTAGCCATCAGCTGGAGCGATAGCACCGCGACGCACATCAGCAACAAACGCCGGTACAACGAT
ACGCTGCATATACTCCGCAGCGTCCTTCGCGGCTGCCTCATCAGCCTCGAGCTGCTTCGCATCAGTGGAAGCCGCATAGTCCATGAAGACGTTCGGGTTG
AGCAGCACCGGTGGGATCTCTTCCTCCTCCTCCTCTTCTTCTTCGGTCTCTTCAGTCTCCTTCTCGGTAGCAGCATCGTCCTTCTTCTCGCCATCATCTT
CAGTACTATTCTGTTGCTTCTCTTTCTCCTCCTCAGCCTTCTTAGCGTCCTTTGCTGCCTTACGGGCCTCGCGGTTGGCACGGCGGGCCTGGTTTTCCTT
CCAGAGCGAGTACAGCTGAACCAGTTCCGGTCGCAACAGAGCAGCATAGCCCTCGTCGTTACGCGTGAAGCATAGCCCGTCCTCTTCAGGAGCAGAATCC
TTCTTTTCCCCCGTGTTCTTCAGAGCAGCATCACGTTGCTTGTAGAATGTCCAGTCCTTCGGAGTAATGCGGACGAGATCCAAGACGTACAGACGTCCGT
CCGAGCCTTGGATTCCCTTGGCCTCTACGGCACCGCAAATGGTTGCAACGTCAGTGCTGGCCTCACCACCACTCACAGGAGCAATGCCTAAAGCTTCCTG
CTCCTTCTCAGCAGCCAAGTCTTCTTCACTCTTACCAAGGGGTTTAATACTACGCTCAGCAATGTGCAGCTTCTTGCCTGCTTCAAGCATGAGCTCGTGC
ATCTTGCTGTTGGCCGCAATGGTCTTTCCGTGGTCCACCGAGCCGTACACAAGCTTCGAGGCAGCGTCTCCCATCAGGATTCCCGGGATAAGACTCTGGG
CGATGACACGAACACCAAGGTAGTCCACGACGGTCGTGGCCAGAGTGTGCAGACCCTTGACATCCGCTTCATTAAATGCCTTGACGCCCTGCAGGTCGCG
ATTGGCAGCGGAGTAGGCATTCTCCTCGCCTCCAGCAGCATCCTTAGTAGACTTACCATCAATGGACACCGAGAAGAAGATGTTGTTAAACACATAGACG
TGAGCACTCTTGTCGTCCATGGGATTAATAGGAGGAATGTTCCCCTCCACAATAGCCACTGCACCCTGCGTCGCAGCCTCCACAAACTCCGTCACGATCT
TGTACATGACACGAGCACGCACAATCTCCTCCTTGATTGTATTCTTCGGCAATTCACGACAGCATTGGTACTCTTCGTTCCAGTCGCGCAACACACCACG
CTCGTCCATGCCATAAGTGGTGCAAAGCTCGTCCTCAGCGCGGTTCAGGTCGTAACTGTGCTCCTCCGTCGCTGTAGTCACAGGCGTGTTCCACGGGAGC
TTACCGCCCAGGTTGGAACCAGCAGCCACCATCCATTCAATCGAAGAAGGTCCCTCCTTGGCCAGAGACGCAGCCTTGGTAAGGAGAGCAGCGTATGACT
CCCTGAACTTTGGCGACGCATTGCTCAATACGTCCACCAGCAGGTGCGAGTGGGCTGGAGCAGTCTTGTGTGGACGCGGGTCGAACTTGGTGGCCGTCGA
GCGGTTGACGAAGAATCCGTTGACGTGCGACGTGATGTGGTAGCGTGTGTTGTCACCAGCAATGACCACTTCCAGGTAGAGCAGGTCGCCCGCCAGCTTG
CGCGGTCCTGGAGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACGCAAGCAGGGAGCTTAGCATCCGGCTGCTGCTCGTGCTCCTTCTGCTGGCTGG
TCTCGTTTTGCTGCTGTTGCTTTTGCTTGTGTTGGTTCTTCTTTCCCTTCTTCCCCTTCTTACCCTTAGCAGGCATTTCCGTCTGCTCCGTTTCCTCCTT
CACCGTAGGGGTGGCACCAGGGAACGAGTAGAACTCCGAGAGCTCCGGTACAACGGGGATCTCGATGCCCTCGAGCTTGTGGTGAATCTCACGCAGACGC
TTGAGCTGTTGTTCCGAGATCTCCTTGAGCTTCTTCTCGTCCACCTCCTCGCCCTCTGCAGGTTCCTCCACCTTGTCGGCAGTCTCCGGTTGGGCCTCGG
GTTCCACGGCAGATTGAGGAATCGGGGGGTTGCTCAGCACATCACGGAAGCGACGCACTTGAGCACGCGCCTTGCGGGCGTCGTACTTGTCCAGCACCAT
GCGCAGCGTGACACCATCCGTCACATTCTCGTACTCGCTGAGCTCCACGAAATCATTAAGCGGCAGCCAGCTGTCATCCGTAAGGCTCTTTGCCTCCAAG
TGGTAGCACGTGTAGCATGCAAGCGCTGGAAACTCACCAATGAGCTGGCGAAGTGCTACGACGGTGTCCGAAAGGCTAACACTCTCCAAACGCACAGGTT
GGCCGCTCTTACCAGCGGGAGGCGCCACAAGCACACTGAAAGTCGCTTCCTCCATAGCCACGGTCTCTTCCTGCTGCTGCTCCGGCTGTGCCGGCTCGAC
GATGTCGCTGCTGCCCATGCTGTGGACGGAAATCTTGCTGCTGCTTGCGCTCCGGGGCTAGTTGCGAAAATGCAAGTGCGTTGCAATGTGTGGTGCGCAA
ACGATGAGCCGGTGAGGCCAGAATGCAAATACAGAGGATTGAAGTTGCCATTTTTATGGTTTATAACTTAGGATTAGTAAGATTTCCGCAAACCTTTCGA
AGAGCATGAATATGTTCTTTCTTATTTCATGCGTATTTGGAGAAAAAATTACACACCGAAAAGCCGATCGAACGTAAGTGCTGCCCTGACGTTGATAAAG
GTGTTGCCATGAGCATTAAAATCCAGCACGACCTGCTATTAATGCATGCATTGGTGACAACCCAGTGTCCGAGCTGTACTCGTCGAGCATGGGCTTCCAC
GAGAATTTGCATTTGCTGTGGCTTGAGATCGGGTCGCCTGATCTTGTCCGCATTTGATGGGTATCAAATAAATAGTAGTTTTGATTTCCTTCTCATTTAG
TATTGATATCAGTACCAAGATACTATAATATCGATAGTGATATGCTGCTAGCTGTTCGCCGTAGCTTCCTGGCGTTGGGACCTTCGCTGTCACGTCGCCC
ACTAGCCTCCTTCGGTCTCCGCTCCATGAGCTCCGACGAACGTGCCAAGGCTGATGCCGCGGCCGCCTCGGGCGCTGCCACTGCCGTGGGTGAGACCATC
TTCGACAAGATCATCAACGGGCAAATCCCCGCCAAGATCGCGTATGAGGACGAGCAGTGTCTGGCATTTCACGATGTGAACCCGCAGGCGCCCGTGCACA
TTCTGCTTATTCCCAAGAAGCGCGATGGACTTACCCAGCTCTCGCATGCCGAGGAGCGCCACGAAGCCATCCTGGGCCATCTGCTCTACGCAGCCAAGCT
GGTCGCTAAGCAGCAGAACTTGGACAAGGGTTTCCGCATGGTCATCAACGACGGAGAGGACGGCTGCCAGTCAGTCTTCCACCTGCATCTTCATCTCCTT
GGAGGACGTAAGTTGGGTTGGCCCCCTGGATAAAGGGCAGACTGGCGTGTAGCGCTCCTGAAGAAAAAAAAGAGAGGAAGGGCATTAAGAATTGCGTTGC
AAATTAATGCAAAGCAGTCAATGTGTTGTGGTAAAAGGCAAAACTGGTTGACAATCGTGGTCTACTTTTGTTTTTATCTAGCTGTCCAGAATGTCTGCTC
TAGTAGGTCTACCCTCGGCCGCTGATTTCCTTGTGGAATTGGTCCAGGAACGTCTCCATAAAGGCGTGGCGCTCTTCCGCCAGACGCTTTCCGGCGTTAG
TTTTCATCATACCACGGAGCTTCAATAATTTCTGTAGGCAGGATAAACCCCACAAAATGTCAGCAGTAAGTACGTAGTCGGCAATTGCCGATGAATGCGT
ACCTCGTAGAAATGATTAATGGTAGTGTTGGGGCGGTTCGGATCCATGTACTGCTCTTTAGTCATGCTGTCGATCGGGGGAACGTCCGGGTCGTATAGCG
GTCGCAGTTTGTGTCCTCCGTACGTGAAACAGCGTGCAATTCCAATGGCTCCAATTGCATCCTGCACACCGAAGGCATGTCAGATAACCCGCGCATTTGA
AAACCAGGACATTTATGACCAACAACATACCAGTCGATCGGCATCCTGGACGCAGCCGTACTCGACAGAAAACGAACGCTGACGTGCCAAAATATCGTTA
GTCTCAATAAACATAATTTGCCTAGGCAGCCGCAAGAAATATACTTACCGATCCCTTGCCTTCTAGCTCCTCTTTGAATCCCATGCAGTCAATGATGGTC
ATCACACGTTCAATCTTGTCGTCCGGCACGCTCTCCGACTGCAGGAAGGCCACTGCTCTCTTCGTGGGTTTCTCCTTGTCACTCTGGTACTTCCAGTCGT
CAATATCATGGAGCAGCGCTGCCAAGTCCACAATCTCCAAATTCTCTTCAGGCACGCGCTGCTCACAATTCCCCATCAGTTACAGCAAGCACAAACCGGC
ATCTCCTTTCACACCCACCTCCTCCTGCGCCAGCGTCCTCGCCACTGTCCAGACACGCTCGATATGGCGCCAGTCGTGCGACGCGTCGTTGGTCTTGAGT
TGTTGCTCCACGAACGCCGCTGTGCGCTGCACCAGTCGAGATGTAGCCATCTTCATCACTTCAGTCAAATTGTACACTGGCAGCGGGATCACCGCAAGCA
GCATGACTCATACCCGCCAATACAAATTTGAGCTGTCATATGTTGGCGCCAAAACCGTGCTTACCTCTGATTGGTCAATAAGATCAATAAACTTCAACGT
CCTTTGAAACTCCTCCTTTCAGAGGCTCAGTCTCCAATAAGCACCACAGCCATGAGCAGCTCCCGCGTGAGCTCCAGCCACAGCTCCAGCCATGGGACCA
GGAGCGAGAAACCTCGCAAGATTACAGCCAAGGCGGATGAGCTGGACGCTTACATGGAGAAACTCTATGACGATGACGTCGAGTCCAAGCTGGAAGGTGC
TAAGATGATTCTGCAGCTCGCGGAGTATGCAGGCAACATCGAGGCCCTCGTGCAGAATGAGTCACTAATGGTACGTAGAGTTTTAAGTAGGGAGTAATAT
AGTCACTGATAACCGTACTAATCTATGCTCCTTTGTACAGAGCCTGCTGTCGCGTGTGTTGAATGACGACTACAAGAAGAGCTATGACTTCTCGCTTACA
ATGATACGCATCTTCTGGTGCTTCTCCAACTTCCTACAACTGCATGCATTGCTGGCTAATTACCGCATCGGAGCCATCACGCTCAAGATCGTCGAGTTCG
AGCTCAAGCGCCACCAACTACGCCTCGAAGAGGAAAAGATGCTGGAAGCCGCGGCAAAAGAGATCTCAACAGGGGATACCGACTCGATGGACGATATACT
AGCAAAACTCGACCGCGAGAAGAAGCGCAACAAAAAGCGCATGAAGAAGCAAGACCAACTACTGTGAGGATGCGAGTCTGACAGCAAGTTAACTGTTCTT
GTTGGTCTTTTAACTAACAATTGCACTGCCTTGTCATGCAGCTATGTATGCTTTAGTGTGCTCCTGAACCTAGCGGAAGACATTCACACCGAGCGCAAGA
TGGTCAAGCGGAAGATTGTGGTCTTCTTGACGAAGGTACTTTGTCCGTCCTCTGTCCTATAGATGCAAGCACTTATTTGCTATGTTTTCTTTGCTTTAAA
CGGGGAAGATGCTGGATCGTGTAGCGCCTGATCTGGTAATCCTGACTATCACATTTCTCAAGAAGCTGAGTATTTTTGAGGAGAACAAGGACGCAATGGT
GGAGCTTACCGTGGTGGAAAAGCTAGTGCGATATCTCAACTGTAACCATGACAAGACCATCCAAACAGCACTCAAGTTGCTGTTCAACTTGTCGTTCGAT
CCAAATCTTCGCGAAGTGTTGGTGAGAAACAGTCTCATCCCGAAACTCGTGGAGCTACTCAAGAAGCCTCCTTTTCGGGCGCTTTCCCTTCGAATCCTCT
ACCACCTCAGCATCGACGATCGATGCAAGTCAATGTTTACCTACACAGAGGCAATTCCAATTGTTATGCAACTGGTGATTAATTTCCCACAGAATATTGT
GGCGAAAGAGCTAGCTGCGTTGGCCGTGAACCTCAGCCATAACGCACGCAATGCCGAGCTCATGTGCCAAAACCGTGGTCTAGAAGCACTTGCCTCTCGC
GTATTTCGCACCCGCGATCCGCTCCTGATGAAGGTGATTCGAAACATTTCACTGTGGTCGTACACGCTGCAAGAGGATCTCGTCAGTGATAAGGCGTACA
AGTATCGAGGCATGTGGGCCCCCTTCGTGGTGCCATTCATCGAACTCTGTCTTAACACAGACAACCACGACTTTTCCATTGAAGTTCTGGCAACGCTAGC
GAACATGACGCCAAGTGATCTTCCGACAAAGAGTTCCTGGGACAGATTGGTAACAGAACATTCACTTATCCCGCTTCTCAACAAACTCCTCGTCCCGGGC
TTTTCACAAGATGACATGATCCTGGAAGTCGTGTTGTTTATTTGCACACTCGCGTTGGAGCCAAAGTGTGCTCCCTTGCTGTCATCATCTCGACTGGTGC
GCACACTCCACTCTCTCTTCCAGGAGAAACAGCACGACAACGAGCTCACACTGCAGATCCTTTACGCATTCTATCGCATGCTGCGGCATCCTGAGACGTT
TGAAGAGATTCTCTTCGGTGTTGGCTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCGCCGAATATTGAAGTCCGTCGGATGTGCGATGTGCTCATGGAC
TTGATTCTTGATCATGACCTCAATGACGGAGGAACCATCGGGGACTTCGGCCACCTCATTCGACAGCGTAGGTTTGAGATCCACAATGCTGAGTACCTCG
AGATGATCCACGCGGAAACGCACAGCGCAGTATTCCGACAACACCACAGAATGGACGATGACAGAGGCAAGGACGACGACGATGACAATCACTAACTAGG
TTGTTACCGATCATAATTGTACGTCTCAAGCCAAACATAAAACAAAAATTCAACTACCCGCAATTCTGTTTCCTCACGACTTTAGCCAATTCTCTTCTTC
GTCAAGAATCCAACCACACTCTTACGATCAATTCCAACGCGAGGCAAAGCTTTCTCTGGCCAGTAATTGTTGTGTTCGCTATTGATGGAGGCTCCAGGTG
GGATCACATACATGTTGTACGGGCATTCAGGCGAAATCTTCAATGCGAGTGCTCGAGAGTTGTGCTTCCGCTTGTCCGAATAGCGGACGAGTTGTCGCAC
AAACTTCCAGTGATCATACACGGACTCCAAGTAGAAAAACGCCATTGCCGATTCGTGGAGGTTGCGAACTTCAGTCTCCAATCTCTCCATTCCCACTGTT
CCATCCTGCTTTGCCACGATGCTTCGGCTCTCCGGAAACTGTTCGGGTGCCATCCCGTCGCGCGTATGGCACCAGAAAGCATCGACACGAAACTCGTGAA
AGCCTTTAGTATCGGACGCGTCTTGAATTTCAAAAAGGCACGACCAAGCGACGGCGTTCCTGGTCACTGGCAGCTCACCATCGATCGCAATCTTCTCATC
GTCTCCGTCGTTTGGCTTCGTATCAAGACCACAATCGATCAAATCAAACAAAAACTGAGCTGCCCTCCACTCAGCCAAGCGACGAGCATCCGCCTCGGTA
TCCCACGTAGCCCGACAAAGCACATGGTCATCAACGCGTACAGCGCAATGGGCGCAAGAAGTTGTGCGAGAGTTTCGAGCAAAGGACGTGCGAGGCGGGT
CCTCCACTGTAGTTATGATCTGGAACAAAATAAATTTACAAAATTTTTAGTTCGGAGCTGTAATAGGAAGCACATGGACACGAGTTACATACACTGGCGA
TGCCTGACAACTTAAGGTCCCGAAAGGAGTCGATTGGTGAGGCATATGCAAGAGATTTCACGTCCAGGAAGTGAAGAAGCTGTGCCCAGATCGACCGAAT
CCTGTTCAGCTTGTTTAGCATACCGTCGACAGCAGCATTGCAAGCATCAGACTTGGACACCTCCGACGCCTTGAAATGAATGACATCATTGACATCGACA
TGAACTTCATAGGTGCCTTCTCGAAGACGCTCCATCCTGATATTCGCTGTAACATTGGGAACAATTCTTTTGTTTTCGGCTCCACGATACTTCAGCGATG
CCCGAAGTCGATTGATTCCAGCGCAAAGGTCGTCTGTAGGAGTGAACAGACTACGGATTGCAGCGCGGAACTTGGCATCATCGGACAGATTACTCTCGCA
ACGTTCGTCATATTCCTTTTTCAGCTCATTTTCGAAAGCTATAGTCTGTTGTGACACGACGCGAGCATCTTCTGCCGTTTTAACTCCAGAAGGTTCCCAG
TCATCGTCATCGTAACCATCCGAGTAGTTATCGAAGTCATCATCATCATCCATCTCATCGTCACTGCACAATATGAGATTAGTCTTCTTGAGTGGAGTTG
ATGCCGATGCACTCCTCGCCGTAGACTGTGATGCTGCTGCAGTGCTCGCCGTATTGGAGCTTCCATTTGAGGAAGCGGACTTCAACTTGTTCAGAGATTC
CAGAATGTCACGCCACCTTTCATTGGCAGAACGCTTCGCATCTTTTGCGTTTAAACATGCCGTGGAAATGGCGAGCGTGTCGCGGACCTTAATAAAATAC
ATGGAAAGCGGGGGAACCAGCTTTTCCGACGCTGACACCTACAACAGAGTGCGTGCACAGAAAATACAGACAATTAGGTTTTCATCATACCGTTACCACC
GTGGACGTAGTCTTACCTTGTCATGATTCTTCGCTTGAGTCTCATTACCAGCCATCAAAGTGGTTGGAGTTTGCTTCAGTCGGTCATTATAGGTTGCAAG
TAGTGCCTCCCACGTCTTGATCATCCCATCCAGAGTAGTAATCAGAATCGAAGTCGCCTTATCCTTCGCGACTTCTATAGACGGCCCTTCTCCACAAGCC
TCGACCACGCCTTCAGATGCAGTGAGTACGCACCTAACAAAACCATTTTGCTGTGTGGCGGTCCGGCAGATCTACAAGTTATAAGCGCACACAATAAACC
AATCAATATACAGTCTGAAGATCAGGCTTGAGTGCTTACTGTAAAACTCGGCGATAGCCTAATTGTCTCCGTCTTAGCACCCAGATTCCACACAATCGCT
CTGATGGTTCCAACAACCTTTTCTCGATCTCGAAAGAGTAGCATTAACAGCTCTTGATACACGTCCGACTTCGCCTTGGCGACCACATCTTCAGACCGTG
CAGGTGCATCACGAGTTGGATCGGAACCGCTTCGGTCCTCCATAAACAAACTTGGTGGACTCGCCGCTGCTTCAGCATTATCTTGTCGCTCGGCGTAACT
TCTATCGGGTGGTACATACGCAGGTGCTTGCGGTTCTGGGGCTGAATACGATAAGCGGGGACGAGGAGCACCACGCTCGTCTTCATAACACTCTTCATCG
TGTGGGGCATAGCGCCGCTTTTTCAAAATACCCATAGATCGTAACTCTGTGACCCTGTTATCACCATTTTCAAAGCTCCCCGCGTATTCGTGTACGTCGG
CCATCCCATCGTAACCAGTTTCGTGGACGTCAACCATTTCATCGTACCTATTCTCCTCATCGTGATTATAAACGTTATCTTGGTGAGGCTGAGTACTTTC
ACTTGTGGGTTCAGATTCACTCTTAAATTGTTCTGCGCGGTCCCGCGTCTGGCTCTCCTCGTACTGATCGATCAATTCCATCAGAAACACCATGAGTGCG
TCGACAACTTCGCTTTTTGTGCTCGGGAGAGACGAGCCTCGCCTACAAATGAGAGGAAACTCTTGGATGTGTGCAACTACATCATAACTGACGTTGTTAG
GATCCCCACTGGGCTTTTCATGAAACTGTGCAGAGCAAGGAACATATTAAACTTCACAAATTCACAGATCCATGCCTCGGAATGAAAGCAAACGTACCCG
CACAATCTTTTTCGTGACAAGATAGCTGAAGGTCGCGTCGTTTACCTTCCGGGTGTCATTCTCTTTGCAGAAGCCAAAACGAGTCTTCAAATACGACAGC
ATCTCACTGTACAATCTTCGATGTTCCCTCACTGCCCTTATCAGCCTTGATAGTGCACCGAAAGTGGCATCTCGATCAATTGTACCAGAGCAATCGAACG
ATAAGTGCCCTAAACGGACACGCGCGATATACTGAGTTCCAGCCTTCTTCAATTCGCGTCGAAGCTGGTTAAGAAAAAAACTCAGTCACATTGTAGCACT
TAACATCATACTATAAAATACGATGCGCACCTTAAGTCCTGCCGCCAACGTAAAGTCCTTGCTCATCGACACCAATGACACAGTTTGAACAGCACTAGCC
AACTCTTCAATCGATGACACAATGTCAACGTTAGGGCTGACCAATGCCAGAAGATACGATCGGCCTTCATCACAACCGAAGGTCCTGGGTTTGGCAATAG
CGCTAACATCACTCTGTTGTCCCTGCTGAGGCTGGAGAGAAGGGCTCGGGGTCGGTGTTGTAGCTTCAGAACGCGTAGAGTTTTGTTTTGGAGCTCTAAT
ATGCGGCGGCGTATCAGAATCCATAGCAAACGTTACTCTTTTCTTCACGAGAGCCCCCGACGTAGATGATTGTGGTCGTTTCTGACGCAGAATTGAAGTA
GTGTTTGACAGAGCAAGAGGATCACTATTGTAACTCTCGTTTTCTGGTTGTTCAGGTAGCATATCCACGGCCATGTTTTCCACTGGTTGTTCCAGACTCT
TTTCATCGGCCATGACGACATCTTTATCCACCGAATCCTCCACTTCTTCGGCTGTGATTGCATCGTACCACATGAGAAACTTGTCGGTAAACTGGAAGGT
CTTGTCCTCCATTAACGTTTTTCGCGCGTCGCCAGTCATAATCTTGACGTACATCAACATCCTTTTAGCTGAGTGCAGTCGCTGCACTGCCAATCGATCC
TGCTGGATCATTGCATCGTAGCGCTTCACTAGCTGTTGGTGATGGGTTATTATCTCGTCTAACATACGCAGCATGCGTCCTGGGGTGTGCCCCTGTCTCG
AATCCGGCTGTACTGCATTCCCCATTCGAATAAAGCGCAGCACCACCGTCCTTGAGGTAGATCTGTCCTTCTCCTGCTTGATGCTGACCTCTGTACCCAT
AGCTGCTACGTCCTTATGCATCTGTTTAAGCTTCCTGGGGCAAAGGAGGAAATCCTGGACGTCCATGCCAACGAAATAGTCATAAGGCTCGATGGTATAA
ATGGGAGTAGCGCATCTGCCAGCCACTTTATCCACAAACTCCATTGGATATTGAGGCGCCTCAGTCTTCTCCACTTGGAACACGTGAGCGTTCATGGGAG
CTGACACCGAGATGCCAAAGTGTGTGGACAACTCCAGGTTCGGGAAGGGCCTGCGAGGCAGTGAGTAGTGGACCTCGTAGGCATGACCTAGCGATAGCAG
CTTCCGCGCAGCAAGAGCGACCTCCATGCGCCACAGACGCACACTCATGTCAAAGGCCAGAGCCTTGTTGGTCTCGGGCAGAGAGAGCGGCGAGTCCGCG
CTCTCCTCCAACGGACCCATGATCGACGAAAAGATGATGGCGGATTTACTTTTGACTGCTTCGACACTGGCGGCATACAGAACTGCGAGAGCTGATGGTA
TCTGAAAACGGAGGTATTGGATTTCACAAGGCAACTTCAACTCACTCGAGGGACGAGACGATGATGAAGAGAAAAAAAAAATGCGTTGTTGCAGGATAGG
ATGGCCGCACAGATTCAGCGCAATGTTGAGCGATATGCTAGCAACGGTGATAAATTGTTGTTGAAGTCTCTAGCTCTGACTTCTAAGCGCTATTCCATGA
GGAAGATACGGCTAGCTACATCGCCGACGAGCCAGTCGATGCCGTCCACAAGGCCATCTCCAGTGACGGCGCTACAGGAAATAATACTCCAGTGTCGGGT
TGAGAACTGAGCTGAACGCAAGCCCAACGCATCTGCGATCTCTGCGGAGGAGAGTGCACCAGGTAAATCCTGCTTATTGGCGAAGATCAGCAACGTAGCT
CCAGCTAGTTTCTAAAAAAGCATTATAGTAGCAGATGAGCTTTCGAGAAGCAAATAAAGGGAGGAAGGCAATAGCGAGATGCAGCACCTCTTGGGTCAAC
AGACTTGTAAGTTCACGCTTGCAGTCCTCAAGCCTCCGTCGGTCGGCGCTGTCCACCACCCACACGAGGCCATCCGTCTGGAGGATCGGCCACAGACACA
CACAATTTTTAGCATGATTTTCACACTCGAGCAACGCGTAAGAGCATGAACCTGTTCAAAGTAGTTTCTCCAGTACGAGCGGATTGTCTGCTGACCACCG
ACGTCCCATACATTTAATTTAAAGCTGCGGTAAGAGTAGCCGCGTGCCATTCCAGTTAGACTGCTGAGATCGAGAGGTCCAGCATCAACAATTTGCCACA
TGTTACGTACTCCTTGTATTCGAGCGTCTGAATGTCGAAACCCAGCGTAGGTGAGATCTCAGTGATATCCTGACCCATAAACTTCTTCAGGATCGTCGTC
TTGCCAGCATTGTCCAGACCTCTGGTGAGCCAAATCAAGCCGCACAGGTTTCAGTAAACGGACAAAGCAACGAGTCAGACGCATGGACGCACAGCATGAG
GACGCGGATCTCCTTTTCCTTCTCCTTGACCTTCTTGAGGATACTCAGCAGTCCCATGGCGGCCTAGCTCTGGTGTCGCTGGTGGCTCAATGATCGCGAC
TCGTTATTGCAATATTTACCGTTCAGTATTGCAAATTTTGCCTTACGAAGAGGCACGAAACGACACGATATTCATGTGCAGGTTACAGCAGTTGCCGCCC
GATACCCATGACCAAGGCCATTCCACCCAGCCGTTTACTGCTGACGAAGCTCGATGGCAACCAGGAGGATGCGCACACACCGGAGCCTAGCAATCGGTCG
TCAAAATTTTATTTTCCTCTGCAGCAAGAGCCGTCTCCAGACTGTGACGACGACACAGCGACAAGAGATACAAGCACACCCACATCACTGAAAGATCTTT
TGGATCTAGAGCTAGATTTGGTTCTCCCTGCGAATGCAATCGCAGCGCCACTCAGTAATCAGCTACCGTCTTCTGCACCGCAGGATGAAAAAATGGAGTC
TGATGACAACTCTGTTTCGTTGGAGCTCCTGGTGAGTGCGCATGATTGACATCGAGTTGATTACAACAACTATTTGCATATAATTGGGTCTTTTGCTACC
ACAGGCGATGCAGAGCCCACACGGCGAGAACCAACAGTGGCAGAACAACGGTGAAGAAGAAGATGAGCAACATGTGAAAGTCACCCCAAGTGCAGTCCCG
GAACATTCCCCCCAACGCAAGATGAGAGGGGTGACGACCTCTAGGAAACCAATGTCGCTGAATATTGCCTCGCCGACGGCGTTTATTCCATCGTTCCCTC
CACTGCCCACCCTGCAGTCTACAGACGACGACTACGGGTTAGCTTCTCCTATGGCGTTGCCAGATACACCTTCGCAAGTTCAACTAGGGATTAGCTTTTC
TTGGGATATTGACCCAACTTCTTTACAGTCTGAAGAAGTACACACAAGAGGAGAAGGTTCTCGTTGTCGTGTACAATCCAAGAGCGTCCAAAAACCAGAG
CGACGAGCCTCATCGGCTTCGGTTGGGAACAAAGCTGCTACACCAAACCCAAAAAATTACGCACCGACTAGATCAACGTCAAGAATGACGAGATCCTCAC
TCCCAGCATTGCCGGAATTTCGAAAGAAGGCGAGGCATGGCGGGATCTACTCGTTGTTACTGAAGAACACATCCGTGAAACAAGAACCAGTCCTCGTAGA
AGATGCACACAATCCTGAAGGTATGTTGCGTCGCCGTGTTTTATCTAGTAGCGCTGCCTTGGTTAACTCCGTGGTTGACACTATCCCCTACAGAAATAGC
GACGGCGCCATCCACGTCCAAGGTGAGAAACGAGAATATTTTCATACCGACAGCGCTAACACGAAACCTTGTGCGTAGATGTCACCTCCACGTACGTTCA
GCCAGCAAAAGCATGGGGGTATTTATAAGATGCTTCGAGGTAAACATGGGCCACGTTAAAGCACTTCGATCTCAATCAATTACCTTGGTCTTGCCAAATT
GGCAGCTTTTCACGTTTTGCCTATCAAGTGGATTTTTTGTCGGGTTACAATCATTCCAGCATAATAATTTTGCATTTAGTAAACTAGTTGCTTGTTGAAT
TTGTCATTTTACAAGATGAACCGCATTTTCGGCAAGAAGAAACCCGAGACGCCACCCGTTAATATCTCCGATGTGGGGGGAAAGGTGGATGCCCGGGTCA
CCGACTTGGACATGAAGGTGCGTGACTGTTGCTCTGTCCGCTCGGTTCCACAGGAGACGCAGTGGTTGCTGACTTGTTGTCGGCGCAGATCGAGAAGCTG
GACCAGGAGCTCCGCAAGTATCGCGAGCAGATGAAGAAGACACGGGGACCAGCCGTCAACTCGATAAAGCAGCGAGCCATGCAGACGCTCAAGCGCAAGA
AAATGTTCGAGGCGCAACGCGATAAGCTGCAGGCTCAGTCTTTTAATATTGAACAGGTGGGATCACCGACGGCTGTGCTGTACCAGGCTAGTCTTTGCTT
CTGATATTCTTGTTATCGTCTTCCAGGCGGCATTTGCCATAGATACATCAAGAGACACGATCTCTACCGTCGCTGCCATGAAGAGTGCCGCAGTACAGCT
GAAGGCAGAGACCCAGAAAATCGACATTTCGGAACTGGAGGTGGGTAGACGAGGGTCATGACATTCGAAGCTTAATTATCGGGTCGATTATATGTACTGT
GTGGTTTGATACAATGCAGGACGTGCAAGATGACATGGCCGACCTAATGGAGGATATGAACGAGATTCAAGAGATTATGGGTCGTTCCTACGGGTACGCA
CACATGGAAGTCGCACCGGCGCAGGTGTACTCTTGCAGAATTGTTTCTAACGTCACGATATTGTCATCGACCTGCAGGATTGGTGACGAAATCGACGAGG
ACGAACTGGAGGCAGAGCTGGAAGGGCTGGAAGAAGAATGGGCTGAGGAGGAGGCACTCGGAGAGGACGCAGAGGCTGCCCCATCCTACCTTACGCCCGC
TCAGCATCACGAGTTGCCTGCTGCTCCCTCGGGAGCTTTAGACTCTGGCAGGACGGCTCGCGCCACCGACGAATTCGGCCTTCCAGTTGCGTCCTACTCG
ACGTAGCGCTGGGATTCTTTAACACCTGCCACACATAACAGAGATCCTATTGACTTGGTTGGATCTCTGTTACGTTCGGTAGTACCGGGAATATATTTCA
GCATCTGCAGCCACCACTTGCTTGGCCACGCACTTGTCAAATGGGAGAGACGGGTACACACCACGTCGGTCGCGTCAGTGCGAGCCACGCGATTGGCCGA
GCTAAGACAGCCAATCGTTTCTCGATATCAAATTGGAAGGGGGAAGTGCGACTTGAGCAGGATATGTGTTCTGGAGCCACAGTTACAGTACCTTGTTTAT
CTAACTTCATTGGTATGGAGTTATAATATTTCACAAACGTCTGAGGTTTTTATTCAAGTCGAGGTTTTATCCTTCTCTGCGCCACGCATTTGCTTGGCTC
ACTTTGGTATTGGTGGTTTTGGCGCACAGCTCTTCGTCCAGACAACAGAACTCCGCAACCATGGCTCGTGAGAAGAAGGAACCGCGCGTGAAGAGAGAGC
GTAAGGGCAAGAAGGAGTCGCGCAAGAAAGCGGCTGAGGAGAAGAAAGCTGCTGAGAAGGCCGAGGCGCTTGAGAACATGTCGCTAGCCGACCGCCTCGC
CGAGGAAGGCATTATCGCCACCTGCTCGCACAATGTGCGCTCTGTCCACAAAAACTTCAAGGACATTAACGTGCTCAACTTCAGCATCACATACTTCGGC
AAGGTGCTCATGGAAGAGTGCGACATTTCGCTTAACTATGGCCGTCGCTACGGTCTCATTGGCCGCAACGGTTCTGGTAAGTCTACCTTCATGAACGTGC
TGGGTGCGCGTGGCATTCCCATCCCGGAGAGCATCGATATCTACCACCTTAAGCACGAAATCGAAGCTAGCGACATGACGGCGCTCGAGGCCGTGCTGTC
TGTCGACGAGGAGCGTAACAAGCTCCAGGCTGAAGCTGACTTGCTCTCGGAGCAGATGACCGACGAGTCTCTCAGTGAGGAGGAAAGTGAATCCATCTCG
GACCGCCTCACGGACCTGTATGAGCGTCTCGACGACATGGATGCCGCTACGGCCGAAGTCCGTGCTCGCCAGATTCTTGCTGGTCTGACGTTTTCTGACG
CTATGATGAACAAGAAGACCAAGGAGTTCTCTGGTGGTTGGCGTATGCGTATCGCTCTCGCTCGTGCTCTGTTCATTCAGCCGACGCTTCTGCTACTCGA
TGAACCGACCAATCACTTGGACATGGAGGCTGTTGTCTGGCTTGAGGACTATTTGTCCAAGTGGAAGAAGATTCTGCTCATGATTTCGCACTCGCAGGAG
TTCATGAACGAGGTCTGCACGAACATCATTGACCTCACCAACAAAAAACTCGAGTACTATGCCGGTAACTACGATACGTACGTGCGTACGAAGGCCGAAA
AGGAGGAAAACCAGATGAAGCGCTACAACTGGGAGCAGGACCAGATCAAGCACATGAAGGAATACATTGCCAAGTTCGGTCACGGTTCCGCCAAGCTTGC
TCGTCAGGCTCAGAGTAAGGAGAAGACGCTGGCCAAGATGGTGCGTGAAGGTCTTACGGAGAAAGTCGAGAAGGAGTCGATGGGCGACTTCAAATTCCCC
AACCCGGAGCCGCTGCCGCCTCCGGTGCTTATGTTCCAGAACGTGGCGTTCGGTTACCCGAACTGCCCTCTGCTGTACTCTGGCGTCGAGATGGGTCTGG
ACTTGGACTCCCGTGTCGCTCTTGTTGGTGCTAACGGTACTGGTAAGACCACGCTGCTGAAGTTGATCACAGGCGACTTGGTGCCTGTTGCTGGCAATGT
TCGACCACACAGCAAGTTGCGTATTGCTCGTTTCAGTCAGCACTTCGTCGATGTGCTGGATCTGTCCAAATCTCCGCTTGAATACTTCCGTTCGCTGTTC
GAGACTAAGTCGGTTGAGGAAGTGCGAAGCTACCTGGGCCGATACGGTATCACCGGTGAGGTGCAGACACAGATCATGGGTCAGTTGTCTGACGGTCAGA
AGAGTCGTGTTGTGTTCGCTTACATGGCACAGCAGAACGCTCACATGCTGCTGCTTGATGAGCCAACGAACCACTTGGATATGGAGTCGATCGATGCGCT
GGCTCGCGCCATTAACAACTTCAAGGGTGGCATGCTGCTGGTTAGTCACGACATGCGATTGATTTCCCAGGTTGCCAAGGAGATTTGGCTTGTGGAGAAC
CAGTCTATCAAGGTGTACCAGGGCGAGATCTCCGACTTCAAGATGCGTGTGCGTAAGCAGCTCAAGCTGGCGGACAAGGAGCCCGTCAAGCCTGCTGACG
AGTAAATGCGCTCGCCAGTTGATCGCTCATTAGATGCTTGCTACATGTAGAACTGCTGTGGCGATACCGTCGCCATTCTGTTCATATTTGATTCTGTTTG
CCAACTGATAAAGCATAGATTGGAAAATCAGACGTTGGCTCTTGATATCCTTTTTCTTAAACTTAGTCTTCGTCTGCTTGGTTGTTGTCCTCGTGGCTGT
CTGCATCGTTGCTGATTCTTATAGCACTAACCGAACAGTGGACAACTGAATTGGTGCTGGATTGCTCGTCTTCGTCGTCTGTGTCTCCGTCGCTTTCCTT
ACCACCGCGTTGTCTGTACAGTGACGCTGGAATGCTGACAAAATTGCTCGACGTAAGTCCACTTGACAGACGGCTGATCCAGGACGTACTATTGATTCGA
CTGCCATTGTGTCTTCTGATCAATTGCTGACGGTGGGTTCTACCTGCACTTCTTGCTCTATTGAAGAAACGCAAGTGCTGATTGTCCACGAGAACGCAGC
CACAGCTCGCATCGTCGCCTAGACCATGATCCTTCGACGTAGAAAATATGGTGATGACACGTGCAGAGTTACTAAAGGACAGTCCCTCTCGAGCAGCTTC
GTGAGCTCTCAAGATGCGAGAGAAGCCGTATTGACCTAGAAACTGGTCAATTGCTCGGGACCCGAAGCGCACAGCAACTCCACCGCGCGGGCTCTTGCCG
AAACCTTTAGAGTCCAGCCTCCAACTGCTTGCCCGTGTCAAAGACTCTTCGTTTCGAACCGGATCGCCCCAGATCATGTCTGCGATCATGGATAGTTGCG
GTTTACCAGCATAGAACGCAATATCCAAGGTGTCTAGCGATGCTGCTGTTGGCAATTTCGCCATCGTCTCAAGAAGGTCCTCATTTTCGTCAATCGGTCT
TGGAATCCCACCATGCACACAGAAAACATCGTTGTCAATGACCGCAGCGACAGGCAAGCGATCGAATGAGTTATTGAGCTGGTGCCAGATGACAGAACCT
TCACTTGTTCCGAACCGTGCCTTGCACTGTGCCAGTAAACACCCAGAACCGTAATGCGCCTCAAGGCCATTGACAGCACGAGTTTCGTGATTGCCTCGTA
GCAGAAAAATCTTGCCTGGGTAGAGAAGTTTGTGTGCGAAGAGGTAGGCTATGCATTCAAGGGATGAACTGCCGCGGTCTACGTAGTCGCCGAGGAAGAG
GAAGCTACCCGCTGTGAGTTCCAGCCCGAGGTGCCAAATATTATCCGCGAAGAAGCGCAAGTCGGTCCAGTTGCCGTGAACGTCGCCGAATACATACACC
GGACTAGGTAGATCCAAACAACGAGCTTCAGTCTCCAGTATTGCACCAACCTGAACGCTTAGCTCAACAAGGTCAGCAGCAAATTGAAGAGAACGCAAAT
AAGGCTGAGTCGTCATCATGGGGTCCGCCAATGCTGCAAGCACTCGTCGTGCTACTGCAATCTCGCCAGTGGCAGGAATGGAAAATGGTCGTAGAGACGC
CAATACCTGCGCCGACTTAATACTTCCCAGGCGGTCAATTCGTCCGGATGGCTTTACGCCTGAGTCCGTGATGGAGTACACGGTTGGAACAAGCGTGTGC
GGTGACGATGCCGTAATTTCTGTTGACGCTTGATACGTCGTTCTGGAGTTAGCGCTTGTGGATTTTTCTGGAGACGTTGAACGACTCGAAGACGCTGCCG
AAGCAAGCTGCTGCTTGAGAAACGCGATCTCCTTATCCGTCTCCAGCTTCAAGGCAACATACGAGTCACGAAGTTTCTACAAGCAACACAAACAATGTTA
GTCCACTGTAACCAGTATTCAAGATGTGACATTATACTAACCTACCTGAAGTTCTCGCGCATTTTGCTCTTCGCGCAGAAAGCAGGCTTTAGTGCAGCGC
GTCGGGGACAGACTATCGAGTACATTGCTCTGCGGGGGGCTGGTCTGGTGCTGGTGAAGCTGTTCTCCAATACTGTAGCTCATCTTAACCGTTTCTTTAT
GTTGCTCGATGCGTGGAGTTAGAACGATAATGTCCACGGTGAATGATAGATAGTGGCGTCATGCAGCTCCGAGGTCTTCCGCTTTGAGTTCCTTGCTCCA
GAAATAGACGTAGTAGGAGACGTAACGACAAAGTGACCAGCTAAAAAAATCTTCGCGAAAAGTTATCCCGTCTAGATGCGTTGGTGGGTGGTGGCGTTTG
TAAGTCTGCTGGTGGTTAGCTTGCCGCATCTAGAATGTGGCCGAGCGAGAACAATCGATTATGATGCACTGGAAAAAGCGTGGGAGGCCGGGGATGAGGA
GCAGGAGCTGCGTACGGAAGGAGACGAACACTATCGACAACTTACAGACAAGTATGTGCACAAACAACAGAAATACAGTAGGTACTCACTTTCGTACCAT
TATTCAGGAATGAGGAGGAGGCGAAGGCACTTGGACCCCAAATGATATTCGCCACACTGACAGACGAACATGAACTCCTTTCTGAAATTGCGTCACGCTG
GAAAGAGGTGAACAATTTTGCAACTCTATCATCATCCAGCTATCTTACAATTGTTTTCTTGCTGTAGATGATGTGGAATGGAGGTATCGAGGTCAACATC
TACGAAGTGGCCAATTCCAAGTTGCTCGTCGGACTGCAAAAGGGGATTTTTCTAAGCGATGTCATGAGGTTCCTCGACGAGCAGAACGAAGTGAAGGAGT
ACGAGTGGAATGGCAAAGCGTACTCGAAGGACAACCACAAAGGAAATCACCACAAGAAGGATACCAAAAAGCTTCAACGAAAAAAGACGAGGGGACGAGG
CACTAAAGACTCAAAAGTCTCGAGGAAGCGCCAAAAATCTGTGGATACGACAGAGAAGCACGACGAACTGTAGTTTCTCATTGAAATCCAATGATACCAG
AACTTATCACTGTAGTCAATCCACCCACCATTCCACCTTCGCTCTGACCGTTGTCACGACGTCAGTCGTAGACCTCAGTTACTCGTGCGCTCACTTCGAA
TATTTTCCAGAAGCGGACCCAGCATTTTATTCTTCTTCGCGTTCTCCATCACTGCATTCAGTCTTGGGTGCGAGTCTGTGTCTCGCACAGCGCTGATAGC
ATCGAGAGCACGCAACGCGCTGCGGATGAGGTCTTTGACGCGCTCGACCTCGGGGCCAACCTGGTCTTCTTTCACCTTCTTGTTGATCGTCTTCTCTAGC
GGCTCCACCAACGAATCTAGCGCGCCGACAATACTGCCAGGCTGCACGTAGCAGATCTTGATCAAGATCTGATGGCTGAGCATCTGGATATCGTCCTGAT
CTCCCAGACCTCGTTTCAGCTGATCAAAGAACAAACTGATATCGAGTTGCTGCGGCAGCACCTGGATCAAAGTTTCCACACACGAGTACGCAGCCTTACG
AAGAGGGAGACCATCATCCACCTTGTGCTTGAACGGACCGAGATCCACCACACGCTCCAACTTGATTTCAGTCGTCTTCAACAGGACGGGGAAGATGCGT
TCTCGAACGTATGGCACGAGATAGTGTGCGTGGTGGTGAGCAGCCGTGTTGAGCACCAGTAAGGCAGCACGACGCACGTGTAGATCTTCTTCGTCTTCAA
GAGCAGCCAAGAAGGGATCGATGTGAGCGAAGATCGCGTTGACTGCTGGCTCCTGAGCTGTCGTTGTCATCGCGTATTTGAGACTTGTTACTGCAGTCCA
ACGCGACCAGACGTCTGAAGATCCACACAGATCCGTCACAATCGGCATGATCTTCGCGCTGTTCGTCACAGCGAGCTTGCCCATGCATTCGCCTACCATA
TTCCGCACACCCTCTTCCTGACGCGCACTCATCTTCTGGAGAACAGGAAGGACACGGTCCACATACATAGCGAACCCGTGATGCGGTTGGGCGGCATGGT
CCGAGATGACTTCGCGCAGCGATGTCAGAAGCAGATACGAGTTCTCTCCAAGCTCCAACTTGACCATGATGGTGTCCAGATACTCTTCCATGTTTCCGAC
GCAAATACTACCAAGGGAGTACGCAGCTGCCGCCTTCACTTCTTCGCCCGCATTGTTAAAGCACTTGAGAATAAGCTCCTTCACGTCAGTGTATCCAGCC
AGCTTGATCTTGCGACCGAATTCGCCCAAACAGTAGAGCGCCAGGACTTTATTCTTTTCGGACTCAGTTTGAGTAATATCACCGACGAACTTTGCGAAAG
CCAGCTTACGATTCGCTTCCGTCGTTGCCACGCATGTACCGGCAACACATCGTGCAATGTTCAACACAGAGTGTTTCGATTCTTCAGTAGGTGTAGCCAT
CAATGCCTTGAACAGCTCTGGGAAGCTGCTGCCAGGGGAGTTCAACTGCGTCAGCTGTGCGAAAAGGCCCTTCAGCGCGTCTAGAGTGGGGCCCTGAAGC
ATGGAACTATGGCACAATTCCAGTGCCTTCACTTGAGCATTCTGTAGAAGCGCATCCGTTGAGGCAACGCGCGGGCATACTCGAAGCGAGTTTGACACCA
GTGTAATGCTCATGCGACACAGCTGTAGGTCCACGTCAACAAGAAGTATCGAGGCTTCCAGTACCACTTCGCAGTGTAGACTCTCCGGCATGTTAGCACC
CTTGCTAACGACCAGATCATTGAGAGTGGCCAATGTTGCTTGCTTCAATGTGCGCGACTGCTGACGAAGCAGTTGAGACAGAGCTTGAGTGCACTCCACG
AGAATGGGCGACATATCCAAGTTGAGCTTCGAGCGAGCAATAACTCCAATGGCCTTAATACTTTGGACACGAGTGATTTCGTTGTTGAGACGCTCCATGA
GCAGTGGATAAACTTCTCCGACACGTCCACCAAGCTCATCACCTTCAACCGCAACACAATAATTGTTAGTATTACAACTCACCGTCAACTATACAACCTA
CTAACTCACCGAGTACAGCAACAATTTCTCCGATACTGCTGATTGCAGCCTCCTTAATTTCTTGATCGATGTCATGAACCTTCAAGCTAGGTAGCACCGC
CTCGAAGAAAGGAACCGCGTACGGCTTGTACGTCGCATCTCCATCATCACAGCGGATGATGCGGACTAAAGACTCAATCAGTCCAAGTGCCTTTGCCACG
GTTTTATACCAGTCCCCCTTCGCACACTGTACGGCAACCTGCACGACAGATTCAAGATGCGGTCGGAACGGCTCCACCGTGTGCGTATCCACGAGCAGCC
GAAGAAACAGAAGCGCATCCAGCTTCAAATCAGAGTGCTTGTCTTCCACTGCATTGAGAATGTTCGGCATCAAACGACCGATGTAGTCTCCCAGCTTCCC
ATGCTCTACCATCGCAAGTTCACTCAGCATTGCAACCACGGCACACCGCGATGGAACCGAAGCCTTCATGCCAAACTGCTTATTGGCTCCTACAACTATA
GCATTCAAGCGCTGCTCCAACTGCGTAACACAGGCGTTCGCTGTGGCTGGGTGGAAGGAACCAGATCCATTTGAACTCGGGAGAGTTTTGCGGGTGGTAC
GAAGAAGTTCTGCAAACACCGCAAACACGTCGATACGAACGTTTTCTTCTCGCTCTTTGAAGCGCGAAATCAATGGTTGCGCGCAGTGAATGTAGAGGTG
CTCCAAAAGTTCTGGTCTCGTCGTGATAATTGCCGTTAGAACACGAAGAGTAGCGCGACGAACCTTCCAGCTAGTGTCGTCATCGTCACTGTAGTCACCC
TCATCATCACTGTATTCCTCTTCTTCCTCCTCCATGTCTTCATCTTCATCGGCTGAGTTCACGTAGTTGTAATTGGGGTCGTAGGGGATAAACTGCATCA
CAAGCTTTAGGATAACCTCCACATGAGGCGTGATCTCGTTGTGGCATCGAATCACGAACGCCTCAAACGCCTGAAAACAGTTTCCGCGCAGTTCGTCCGA
GTCTTCGTTCTGTAGCGACTCATCCTCGGGATCTCCGCAGAATTGCACCAGGATGCGAATTACCGCGTCCAAGTGCTGTCCAAGGCGGTGGCCTGCCGTT
CGAGAGAGCATTCCAATAGTCTGAATCAGTGTGCGCACGTTCGATGAGTCGGTGGATCCTTGAATCCCCTTGATCAAGTGCTCCACCAAGCGGCTCACGA
GAACATCAGACGCCATGACACCCAGTGAACCAACACAAGCAGTGGCACGTTTGCGCACCAGCGGCGACTCATCCGTCAGCTGAGCCATCAGCAACTCCAT
GATCGTCGCGTGTTCCGTGGCGACGTCGTAGCCAAAGCGACGCAGTAGATCTGTGAGGATATCGAGCGTCTCAGCCTTCACAGCGGCGTCCTTGTCCTTG
TTCAAACCCGTTAGAAGACGTGTGCAGATGCCAGTGGCAATGGACGCCCCCGTAGTCTGGGAGACGTCAGCTACAATGGTCTTGAGCCCGATCGAGTAGA
TGTCACGGAGCTCCGACTTGCCGTTGAGGATGAGATCACAGAGCTTGGCGCATATATCGGCTACCTGGGACACCTGTACTTTAGTAACCAAAATGCCCAG
ACACTTGACGGCAATGGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTCAGAACCGCCGCACACACTCTGCAACGCAGCATACACAACGAGTGAATC
CTAACTCCTCAGCTACGACACCTAGTTAATGCGTTGTGCGTACTTTGGCTCGAGATACGGCCCCAGGTCGACGTCCTTGTTGAGCTCGACACATAGATCC
GATGTAGCCATGTAGCGTTCATCCTTGTCAAAGTCCGTGGTCTGTAAACTCATACAGAGTGAAGTCATCATCAGAGCGAGCCTCTTCGATATGCAAGATG
CCAACAGTGCATCGCACCTTGTCCAGCAGCTGCGCGATCTTGTCCTCGTTCGCGCGCATCTTGCCCTTCCAGTTCTACTGCGCTTAAAGTGAAAGTGAGT
GACGAAGAAGATTTCGGGTGGATATGTGCACCACATAACATGACCATCACTCTGTGGGAGTTACTTCAACAATGTGGGCGGTCATTCCGCAATTGGAGCT
GCAAGTGGCGTCGCCATGAGTACGTAGGACGAGGAGCGTCTGCTATGGCTGTGAGCGCGCTGGGTAAGCGCTAACTGGTACTGTGTGTCTCTACAGGCGA
AAATGACGGCTCCGTGTCGCCTGATCAGCTCACGTCGCTCATCTCAGACGAGGTGGAGCGCCAACTGCGAGAACGAAGCTTCGTGCTCGAGGCGATGAAG
GAGCAGATGGCCAAGGTACTGGCCGAGTTTGAGGAGATGGCATCCAACGTCAGCTCCAAGCGCTCGTGGTCCAATAGCGTCGCCAAGACGACGAAACCCT
TGGTATCGCCCAAGAAGACGCTGTTCAGCGTGCATCCCGTCGTCTCACCCTTGGATACCGTTCCATTAGCGGCGTCCTCTCCATCCAAACTACCAAAGTA
GCTGAATTGTCTGTTACAGTGTAGTTGGCACACAGTCTATACGTTCTAACTTCGGTTTTAAATTGTCTGTGTAGGATTGGCGGTGGACTTCTTAAAAGCA
TCAACCCCTTTAAGGGCAACGCTAATGGAGGGAGTCTCTCTCCAGGCTATGCAAGATCTCGCAGTCCCGATGGCAAAATTACTTTCGGTACGACTGCTCT
ATACTGCATTTTTATGAGAAATATAAACTAATCGTAGGATTCTTACCATATTCTGGATAGACAAAGTACTTCCACGAGTTGCCAACATTGAAAAACGCCA
TGACGGCTCACAGGTGATACTGTTGCAGCAAAGACATCACATGTATGAGAGAGCCTTAGTGCGATATCCACAGTGTCGAAGTAATGTATTCGCCCCGAGT
GCGTACGATTACGAAGATACCCCTAGCTCGGATGCAAGTGCTGCTCTTCAGGCACCCCAGGCATCGCTAGAACTGGAATATGTGTATGGATGTCGTAGCG
GAGTCACCACGTCACTGTCCAGTAGTCATCCTCCAGCACCGAATGCCAGCACCAACAACAACGCGTTCTATATATCAAATGGTGAGATCATGTGGTTCAC
AGCGACGTTAGTGGTGTTATACAGGAAAGAAACCAACACACAGAGGTTTTTCCGAGAACACACGAATGAAGTTACAAGTGTGGCGATTCATCCAAACCAG
CGAATTGTTGCATCAGGACAAGCGGGGAGATCTGCGTTTGTTCTGGTGTGGAATGCGAATGACGAACCACTTGGCAAGCGGTTTGCATGCCTCAAAGGCC
ATCAAGTTACAGTGAGGTCCATCAGTTTCTCTCACGATGGCAAACTGCTTGCTTCTTTGGGAGGAGACATGTACAATACGATTTGTATTCACGACTGGAA
AGCGCAGGAACTGCTGGTTAGTGCTCGAGGTCATACATTCCGAGTTCATGCGGTCGCCTTTAATCCTTTCCAGGCGTATGGCCGGCCCGAAGCAAATCGA
TCCAAGAAGCCAGGACAGGCTCTACACGACGACGATGCTTGTTACACTCTGGTCAGCTGTGGTGTTCGGCATATTCGCTTTTGGACTCTCACAAAAGGTG
ACTATGTCCCACCCCCTTCAAAGGAAAAGGCGGATAGTGCATTCTATGGGTCCACATTTGGTGGTCCTCAACGATTGCGTCCTCCAACTCCGACTGAAAA
AGTGTGGAAGCTAGAAGGCAACGTCCCGTCATTTCATGGTCGTTTTGAGGTCCAAGATTTTACAAGTTTGACCTTCGTAAATGATTCCCCACCACTCTAC
ATGTATGATGAGCACTCCAAGGAACTAGTCGCGACAAATATCACTGATCATTCTCTTGGCCGGATTGTAGCTGGTACTGCGAAGGGGGATATATGCTTGT
TCTTGCAACCAAGAGCTAGTCCAGGTATTCACACCGTGTCGGAGCGTGATTTACAGAAAGAACCTGCGAAATGGTGGGAAATTCCTGACGAATATACCGA
TGCAGAGATAAACGAGCTCGTGCTGGAAAAAATCACATACGAACCAACAGGAAGACTTGTTGACGTCGTGCCTCACGATCAAGAAACTGGTAATCGATTT
AAGCTACCAAAACAAGCTCAAGTAGAGATGGAAGGCCTGTCCAAGAAAATGGCGCTATGGCCTAACGCGACAGCGTTGCATTCGCGTTTGGATGGACTCA
AGTATAGTGGACCCCTGGCTCACCAAGGAGCAGCGTTTCAAGTGGCATACTCCAAGAAGCGCAATTTGATCATGTCGTGTGGAAATGATGGGAAATTACT
GTTGTGGACATGCCGACTTAGCAAGCCCATGCGAGTTCCTGGAGTTAACACACAAGGCGTTTTCACGCCACTGACAGACACATTTGCAGAAGGTTCGCAC
GCACTACTTCCTTTGGATGACCCGATGAAGGCATTCCATTTGCCTACTGCACTCCCAAATGCATTTAGCGCAGGTGGCAATGCTACTACACCGAAGCCCA
CGAGCATTGTCTGGAAAGATGATGGCAATTTTGTGCTTGTTGCCACTAGCAATAGCTGCATTTGGGAACTCAACATCGTTTCCGGAGAATGGAATTTGCT
TTTTGAAGCTCACACTGGTGCGGTGGCGGCCTGCTCGGCAGACCCTACTGTGCAGGAGGCAGCAACAATATCTCAAGAAGGATATCTTAGATTTTGGGAC
CTCGACCAGCACTTGTGTATACGCCGTCTGTACCTCGGCAATTTCATCAACTCTAGCGTTAAAGCCTTCTGTATGGAGCACCACCCCACCGGCCACGAAC
TTTCAATTGGACTAAGTTCAGGTGAACTCCTGGTTGTGGACTGTCACGATTTTAGGGTCTCGCTACGGAAAAGCATTAAGCCAACCACTGCAAGTACAGC
AAATGCGCATTTGGGCCTATACGGAATCGCCCAGGTGAAGTACTGCCCCAACGGAAAATATTTAGCTGTGGGGGTGAAGGATACTTTTGTGTACATTTTC
GATGTCATCAATGGCTACAAAAAACTCCATGTCTGCGAAGGTCACTCGAGTGCCGTGACGCACTTGACCTGGAATATGGACGGTGACATCCTGCAAAGCA
ATGCAGCGGATGGTGAAATTCTACATTGGCTAATATCTCCTACGAAAGGAGAAACCAAGCAGATTACTGACGCTTTCCTCATTCGCGACGTGCAGTGGAT
TAAATTGACATGCGTGTTTGGGTGGCCAACGCCTGGCATCTGGTCAGAAGACTCACCCAATCTTGTGGACATTGCTGCAGTCTGCACGACGGGTCCAAAG
TCGGTGAATGAGCATGAAGAATTAGAAAACACATACTCAACCTCAAATGAAGACTTGTTGGCTGTTGCTTGTCGATCGAGTATTCATCTTCTCAAGTACC
CTTCTCATCGTGGCGCCAAACGAAAAGTTTACAAGGCTCATTCATCAGCAATTACTGCGATTGGTTTCTCCTTTGACGATGCGTTTTTAGTTACTGTTGG
TGGCGACGATGGAACACTTATACAATGGAAAGTTGTGTCTGAAGGTACAAGTCCTTCTCGTGTCGATGCAAATTTCGGTACGAAAAATGCACATCAAATT
CAGTTAACATACGACGATAACGTCGGAGAACGGCATAGTTCGACTCCTGTTCCTCCCCCACACGATGACAAGCCTAGATCCAGTCAACTCTCACCACGCA
AGCAGTCTCGACAATACCGTGAGCGGCCTATTTATCAAGATGACAGTTTTAAAGAGTTTCAAAATGACCAAATTGACTCCGAAGTACAAGAAGCTGCGTT
AAACGTTAAAAGTTTGCATCAGAGTACGAACGACGGGGATTCGACAACCGATAGAGAAACAAAGGAGGAATCACCTGACACTAACCAAGGTATCAGCTAT
CGAAGGGCAGTGGATAATGACGACCAGCTACCAGTTCCCATCCAAGTTCGTGTAATACGCGACTATACAGCTGAAAAACCGGACGATCTGAGTATGAATC
GTGGGGAAATCCTCCGAGTGCTCTCAAAAGGTAGCGGTGAATGGTGGCTTGGTGAGACGTGTGACGGCACCAAGGGTTATTTTCCTGCTACTTTTGTAGA
AGATATCGACCTTAGCATCCCCTCCACCGACGAAGAGCCCATAGCAAGCGAAGATCAACTAGCAGAAGGGTAAATATGATCAGTACATTTTAAGTTGAAA
TTCGTCTGCGACGTGTGAGAAATAATGGCTACATATCCGGTGGCTCTAGCCTACAAATCACATACCGAATCACACCTTTGGCAATCACTTGCTGGTCGGA
ATGACGACGGCATCCTCCGACACGGCCGCTTCCAGTGCAACGACGTTCAGCGATATACCGCTCCATGGAGACGTGGGCCGTGCACTCACAGCTATGCGCT
TCCTGCGTCCGTCGCCTATTCAGCTGCACGCGCTGCCTGTGACTCTGTTCGGCAACGATGTCATTGGCCAGGCCAAGTCAGGCACGGGCAAGACCGCGGT
CTTCGGAGTCACCGCCATCGAACACGCGATCCGCAACATAGAACAACGAACACAGGAGGTGGAGGATCAAATGGTGGGAGATCCGTTGGCATTGATTCTG
GCGCCGACTCGAGAGATCGCGGTTCAGATTGAGACTGTGCTGCGTCAATTGGCGCAATTCCGACCGGATATCGTCATCCGCACGTGCATCGGTGGGCTGC
CAGTAGCTCAAGATCAGGTAGCGGTGATTGCATAAATGTCGAGATGAGTGACTGTACTAACTCAAATGGTTGTATTAGATTCACTTGGCTGCGGGGTGCC
ATATTGTGGTGGGCACACCAGGCCGCGTGAAAGCGCTCGTAGATCAATGCTCACTGCCATGCAGTGCCATTCGACTGCTTGTTTTGGATGAAGTGGATAA
ACTCATGACACGAGACTTCGAGAAAGATGTAAGAGCATGAATCCGCGATGTGGTTTTGGGTATTGACAGCGTTCGCTACGTGCACAACAGATCCAATATA
TCGCGGATGCACTTCCCGAAAGGCGACAGGTAATGATGCCTTCTTGTCACACGGAGAGTGATAGTTGCCACAGAATTATTTATTTAATGCCTTGTTGTTC
TTCTGATTCAGACACTCGCGTTTTCGGCCACGTTCACAACTGATCAACTTATGGCAGTTGCACAACTAATGAGGACTCCACAGGTAAGGTGCAACCTACA
GTTAGCACAGATAGTGCTATGCGGTTTGTCTCATATATGCCCTTACCTCACCACATTCTCTGTTTCATTTTTTTTTTCAGATCGTGCGGGTTCGGGGGCC
AGGTGATGTCACGACGGAGTTTATTTCGTCTGCTGACGACCTGGAAAAGTGGAAGAAACGAGAGCAATCTAATTCGCCGGAGCTTTGGCTTCGTCATGTA
CGCCAGTTTTACAGTGTTGTCAATACACCATCTGGACCAGCAGCAGGCGACAAGGTGGTGAAGCTGGCAGCACTACTGTCGGAGATCGTATTTGTGCAGT
GTATGGTGTTCTGTAACGATAAATTTCGCGCTGAGGCGTTGGCCACAGCTCTTGCAGCGCAGGGTTGGCCAGCAGCATGTATCACTGGTTCTCAGACACA
AGCTACACGTTTGGAAGTGATGGAAGGCTTTAGAGCATCACGTTCCCGTGTGTTGGTGTCTACAGACCTCACTGCACGAGGTATAGACGTCGACAAAGTC
AACTTTGTGGTACGTTGTTAAATGGTGAAGGGCGGATACTTGGCCTCTGATCGTTGTTTTATTGAATTGTAGGTTAACCTGGATTTGCCACGAGACCCAG
CAACATATTTGCATCGTGTTGGAAGAACAGGGCGTTTTGGTGGGAAAGGATTAGCAGTAACGCTACTCGCGAGAAAAGAAGTACAAGGAATCAGCCTACT
TGCTCGAGTTTTCAAGATGGAGATCAATGAGTTGCCCAGTCCGGTACCAGCAGAGATTTATACCTACGCAGCTCCAGAAGAAAACGGTGGCGGTGAAGAA
GCAGAGGGGCCTGCGGATGGTGTGGTCGACGAAACGTTTCCACCTGAGGTTGTGAGTGAGTCGTACAACTGTGAAGGTAATGACGAGGAGGAAGGAGACA
AGCCTACAGACTCTGCGGCTGCTGGGAAATTTTCGGCTGATGAGACTGAGCATTCAAGTAAGAGGCACAACTATGAAGATGAAGCGGAGAACTCTATATC
AAGTGCAGCAAAAATGGCAGTGGTGAACGAGCAATTGTCGAGAGCTGTCGTAAGCCGATACGATATGGAAGAGAAATCGTATGAAAGCTGGGTGAGGTTA
CTTTAGCTACCTCTGGTTTGACGTTAGATCTTGGCGCTAGCTTCCACATAGAATTGATCTCGTCATTACTCACATCCGCTCGCCATCGTCGCTGTATTCT
GCCTTGTTAGATTTTCTTACAGAACACCACCGAGGGAGGTCAGCCGACTTTCTTCACAACTCGGCGCAAGGTGTTCACTGTTCGAAGCGTGACAGGGACA
CCCAATTTCTTGTCGAAATCTACTTTGAACA