Description :
From Genome Similarity Track
Location :
Scaffold_1426:2575- 6652
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1426-fgenesh-gene-0.0Stomatin

Sequence
4077 bases(100 bases per row)
GTCGTTGAGCGACGCCGACGGCTTCTCGAACGTAAAAAACGCCGACGAATGCAGCGCAGCAGGTGGTTCAGTCGTTCGTCGCATCATGGCCGTCCTGTGG
TAGCTGCTGGTTTACCTTCTTAATGGATTAGCCGGACGCCCTAAAATATTCCACAACAGCTCGTATAAATACACCCCCAACGCATCCACACACGCACATA
CCAGAATGTCTTCATAGCGTTCTCGTATTTGAAAAAAATATCGCGGAGGCCAAAAACTCAACCACAACTAGAGACAAACGGCCTTGGCTTAGTAGTTCTT
GCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGATCCACATCGTCCAGGCTGTCGAGCTTGTACTCTTCCAGGTCGTCCGAGTCT
GCGCCGTCCGCGCCATTGCCGTTCTGCTGCTTGCTCGCGGCGTTCGCGTTCTTCTTCTGGATGTTGCTGAAGATCGAGAGCGCGGACGCGACCATGCTCG
ACGGATCGTTCGTGTTGGACGGCAGCAGCACGGTCGTCGACTCCTTGGCGATCTGGCCGAACGCCTCGACGTACTTTTCCGCGATCTGGAGCGCGACGGC
GTCCTTGCCGCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGCT
TCGAGCACAGCCGCGCGCTTCTTACCCTCGGCGACATTGATATACGCCTGACGTATGATACAACATACACAGTATGTATCAAACAATCACACAGATCAGT
ACTTGTGCTTGCTGCCGCCATACGGGCAGCAAGATAAGCCTACTTGTATAGGCAACAACGCACCTGCCGCTCTCCCTCCGAGTCGAGGATCTCGGCACGC
TTCTTGCGCTCGGCCTCGGCCTGCATGTCCATGGCGGCCTTGACGCTCTTGGGCGGCGCGATGTCGCGAATCTCGTAGCGCAAACACTTGATGCCCCAGG
CCTCGGACGCCTGGTTGATCGACTCGACGATGCTCTTGTTGAGCGACTCGCGCTCCTCGAACGTCTTGTCGAGCGTGATCTTGCCGAGCTCCGAGCGCAT
CGTCGTCTGCGCCAGCTGTGTCACCGCGTAGATCGGGTCTTCCACCTAGTACGCAATTGGTATAAGGACAAGTGCACTTCCAAATGCACATATATTAGTG
CGACACGTACCCCGTAGCTGGCGTTGTACGGGTCGATGATCTTGACGTAGAGCACGCCGTCGATATTGATGGTGACGTTATCCTTGGTGATGGCCGACTG
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTGATGGCCTCTTCCTTGAGCGAGTGCACGTACGAAATCTTGTCCACAAACGGGATCAAAAA
GTGCAGCCCCGGCGTGAGCACGTCGTGGTACTTGCCAAAGCGCTCGACCACCCACGCCTTCTGCTGTGGCACGATCAGCACACCCTAAATATGCGCATGT
ATGTTCACATATTAGTATATGGTATATGCACAAACCAGCATGTATACCAACTGTGCAAGCAGGACATACGATGTTGACTGGGGTCTCCTGCAGGCGCGAG
GACCCGTCGTCGTAGGGCGACGCGAAGAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNGCGACGCGCTGATGGTGCGCACGCTTCCCAGTCGCAATTGTTG
CTGCTGCTGTGTCACGCGCAGCGCGGCCGCACGCCATCGCGGCATCTGTCGCGCCACGGTCGTCGTCATGTTTCCTGCTGCTCTTTGGTTCCTGTTTGCT
TGTTGCGCTGCGGGTTCTTTGTGTGGCAAATGGAAGCACGTCGAAAGAGGATTTTTGCGCGACAACAACCCAAGTGAAACACCCAAACGGGCCAACCTTG
CGCAGTTTTTCACCCACCGTCCATGCAAATGGGCTAAATGTGTCAATGGGTGAAGTTCAATTAAGGAATGTTGGTAGATAGGTTGGAGAATGACGAGCTC
CCGCAGGTCCATTTTCATTTCGACAGTCAGGAATGATGGTACCGTATCCGGATAGCCATTTGGCATCGGTAGTGCTGATGGGCAGGCATGGTCGCTGGCT
GTATTCGCGAAGGCTTATCGACCTAACAGGGCGCCATGCGCAAGAGGGTGGGACCAGCAAGAAGGAGCAGCTCGTGCATCCAGCACCTATCCGTCGTTCC
TAGTTTCCTGGTCAGCGAATGGGGTCGGTACGGTTCAGTCCAGTCGCCAAGCTGAGAACGATCTTTGTCTTCTTCCGCCCCTCCATCTCCCTTGCTGCAC
GACTGCAAGAGTGGCAATTGCGCCTTATAGTAATGTGTGTTGCAGCTCTTCTTTTTCTTCTTCTCTGCGAAACAAAACAACAAACGAGCGTTTCATTTGC
GTTGCATGGTTAAATTTTGCGGCAGACTTCTTTCGTCGTCATCATGTGTGAACATGACCGATTGGTCGTGTCGCAACAAACTCCGTCTCTGCGCTTGCGT
TCAGTGCTGCATGACGGATGCAATGCTGGCAATATTTGCGCATTTACTGTGTGGATAGAGGTGGTAAGCACGCGGTATACAATAACGCCGTGTAAATACC
GGCAGCAGCCATTAAACAAGTGCATCTTCAATGCGACCAGACAAGAACGTTTTGCTTGTCTTTTTATCACCAGCAATTTTTCTGTCTGTCTGTTTCTTTT
CTTCTTGCCTTTTTTTTTTTGAAATTTTAGGAAAATAAAGGGTGGTTGTAATCGCGCAAACCGGTTTTAACCGAGTATTGCTATCCGAAAACTCGCTAAA
TGCCTGGCTCTTCTTTACGCGCGGCGCGCATAGAAAGCGTAAAGTGCGCACACTGGCCCTCGTCGTTCCCCCCTCTTCCTCTTTTTGCGTCATGTTCTCG
CATTACGCAAAATAGAAAAAGCGCCGCCGCCCTTTCCTCCTCCCATTTTGTGTGTCGGGCCGGCCATTCGGCTTCCTTCCAGCAAGCGCAACAAGTGCGC
GCTGCAACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACGAGACGCTTGCAAGCCGCCGC
ATACGCCAGATTCGACAAACTCGCGTGAGTGTGCGTGCGGCCATTCGACACGACGCAACAAACGCAGACCCAGGCAGCAGCAGACAAGCGCATCCGCGAG
TGTTACTTCAGAGGTCTGCGCATTATATCACATTATTCTCATTCTTGCATTAGTTTCTCTCCCCTCCATACAAGACCCACATGGATATTGGCACGGAGGT
GTGGGTCAAGTGCGCGGCGCCGCAGGTGTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCGGCGCAGGACGACGCCGCCAACGAGCTCTGCATCCGCAACAA
AGAGCGCCGCGTGCATGAGCTGGCGGCGCTCACNNNNNNNNNNNNNNNNGCTTTGCGCACGACCAGATCTATACGTCCATCGGCGACATCCTTGTGGCCG
TCAACCCGCTCAAGAGCCTCGCCCTCTACGGCCAGGACCAGATCGACAAGTACAAGGACGCCATGTACGAAGAGCAGCAGGACAGCAGCGGTAGCAGCCG
CATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCGATCCTCGTGAGCGGCGAGAGCGGCTCGGGCAAGACCGAGTCGACCAAGTTCCTCATGCGCTTCCTCACGTCCGTTGNNNNNN
NNNNGATCAGCGAGCTGGCGATGTCGCAGCCGCACGTGTTTGCGATCGGCGCCAANNNNNNNNNNNNNNNNNNNNNN