Description :
From Genome Similarity Track
Location :
Scaffold_34:257458- 260584
Transcript NameFunction/comments
Hyaar_Emoy2805031nuclear pore complex protein Nup155

Sequence
3126 bases(100 bases per row)
TGTGTTGGGCCCATTTACATTAGGGACCATTAATACCGAGTCTTCTACAGCTCGGGCCGCTACACTAGAAAAAGGTTGACCGTGGTCTATATTTCATCAT
TGCTCTCCACTCTTTCTCTCATTGGATAAAATCTACTCGGTCGTCTCTTTCATCCAATCACTGGTCGGCTTATTGCCCCGCTCGATAACATCCAACAACG
TCGACTCGCCTTCCCCCCGCCGTAAAATGGACCTGGCGGCATCTTCTGAGGCAGTTACACGCACGTTCAAGGGCCTGTCCGACGCCAAGACGCGAGTAGA
TCAAGCGACTCAAGAAGACGCGTCTTTCCCAGACCTAGCGGACCAGCTGAACGCCCAATCGGAGCCTCAGAACTATTTCTTTGAACCGTATGCATCCCAA
TGGATCCCTCAAGTCGCGAAAAAGGGATCCGTGATCCCTCTCCCAGGCGTCGTAGCTGCTGCCCTGGACGAGACAAAGACACTGGCACTCTCTGGTCTAT
TACCCGAGATCCGGGCGGTCTGGACGTCCGTGGACACCCGCCTCTTCCTCTGGAGCTACGCCCAACGAGGCCGCTTTGCTGCCAAAGAGTTCGATCAAGC
CATTGTCGCTGTGGGACTCGTCCCTCGGCCAGCTTCAGGCGTGTTTACGTCCAAAGTGTCTCATGTACTGGTGGTGGCTACGACCGTGGAGGTCGTGCTG
CTTGCAGTTGTTGCCGAGAACAATACGTCGGAGACGACGGGTCAAGCGGGGTTTGTCAAGCTCCAGGCTACAAAACTAAGTGTCAGTACTGACAAATGCG
TGGTCCGGAGGATCGTGACCACACGCTGTGGTCGCGTTTTCTTTGGAGGCTCCGATGGTGCGCTCTATGAGGTCTTGTATGCACCTGAGCAAAAAGCAGC
GGCGGACCGCAATTCGCTGCTTGGAGCCGCCTGGACAAATGTTTCGGGCGCGGGCGGAGCAGACGAGTGCAGGAAGATTACGCACACGTCGAGCTACGCA
CAGTATTTGCCAAAGTTCCTTGCTGGATTGGCCAGTGCACCTGGAAAAGTCGTGGACATGTGCGTGGATCACACGCGGCATATTCTCTATGTCCTGCATG
ATGATGCGCTCGTGAGTATTTTTGATCTGGGAGCCAATGGAGACGAGTGCAAGGCAGTGTGTGTTGTCAATCTGTTGGTTGATGGTGCAAAGTATGCTCG
TGAGAACCGCCGGACACGCGTCTCGTGCCCTGACGAGCGGCTTTTTCAGCCGGCAGTGGCTGGGACGTCCAATGCGATGAAGATTGTGGCGTTAGCAACT
GTTTCTCCTGACGAATCGAAAGTAGTCACTCTGGTTGCTGTGACCTCGAACGGCATTCGGTTTTATATGACAGTTTTCTCGCGGCGGTACTTGTATTCCG
AACCTGGCAGTCAGAGTAGAACCAAGCGGCCATCCAGACTCGAGATCCTCCACATTCGACTGCCTCCCCCGGCAATCGCACTGCGTGACGCGCCACCGTA
TCACGCCAAAGAAGGCATGCAACCAGGATATGCTCCGGGCAAGAGTCTAGATGCTGTGCACGTGGCATTCCATCGCAAAGGAGTTTTTTTGTGTATTGAA
GGACGACGAAATGAACAGGACCAGCTCGTGGGTATTGCGTATGACCCTATTAGCACCACAGCGCTTCCTGTTCAGTCGGGTTTGACGGCGAGAAAGCCGA
CAATCCGCGAGGCAGTCTCATTAGACACCTGTATTGGTAAAGTTGTGGACATTCAGGAATTGGACCCGCACTCAAGCGAGGGTTCTGATCGCGCATGGAT
GCAGCAGATGGAGGTTGCAGTATCGACTTCGAAGGGGTCGAGCAGTGGCAGTAAGCGGTCGTTTGACGAAATGTCTACTGGTATCTCCGTTGGGAGTACT
CTTGAGAACGCGCCTGTGGTTGGCGAGATGGCCCTTATGTACTCTCAGCCGTCTCGCCACTTTTTGTGTTTGAGCAATTCGGGCATTCAGGTTTTCAAGA
AGATCCGACCACTGGATCAGCTTCACCGCGTACTTTTACTTTCTCGAGGCCACGAGCTCAATGCCGCACTCACCCCGTTTATACGCTGCTTTGGCGAGAT
TCAAGTGGTCTGCATGCTGCTTGCGCTGGCATGCGGCGTCCCAACAGATCCTCTGGTCAGTGAAACCTCCACGGCAGCTTCGCTGGTTGCACCGCGCCCG
GGTGGGTTAGCACCGATGAAAAGTGATGATTACATCTATTCAGCTGCCGTACAGTGTATTTTTGAAATTGCTCAGGGACCTCCTGACAACGTGCCTGAGG
AGCCCGCAGGTACATCTACGGTCGTTGGCTCCTCTAGCTCAACGCGTAGTACGCGCATCGTGCTTACCACGGAATTTGGCATGACCTACCAGCATGATGG
TCTTGTAGCTTTTGCGTGTCGTGTGCTGCGACCGCTATGGACAACAGCGACACTTGGCCGGCGTGTGGTTTCTCGCGCGTCTTCTAATAGTATGAATTTC
GACACGTCATCCGCTAAAGCACCTGCGCACATGACCAGCTTCGAGGCTATTCATTCCCCCGATAAGTTGGATGAGATACGTGAGATTTTGTTCCAGCTGA
GGCAATTGATGGAAAGTGCTGGCCCATTTGCCATGTCAATTAGCGGAGGTGCTGCGCTTGAGAACAATCCTAGCTTGGACGGCATAGTAGAAGAAAATGC
TGGATGCGGACTATCGCGCGTATCGGAGCTTGTAGACCGCCACCAGAAGTCGCTTAGTGAAGACCAGTTGAAGCGCGAGATGCGGAGTAAAGCCGAGCAA
CGCTCGCTGTACTACCTTTATCAGATCGTGCTGCGCAGTATTGAAGCTATTTCATTGCTGCGGATTGCGCAAGATTACAAGGTATCTCTGGAGGAACCTC
TTGCCCGGCTTAGCTTCAGCGATTTTGTGTCCACGAAGGAAGGTCTTTTAGCCGCTAAGACTATGTCGAAAGCGCTGATGCGAGGCCACAATGCCAACAA
CCAGTTTCTGATCAAGCAATTACACGAACAGTGTCCCACTTATTTCTCAGTGTCAGATTTGTGGCACTATCAAGGTTACCGAAGCTTGTCCGATGCTAAA
CTTAGTGGATCTCCCGAGGCTCGCAA