Description :
From Genome Similarity Track
Location :
scaffold_116:25736- 28266
Transcript NameFunction/comments
Pl_109408hypothetical protein PHYSODRAFT_347972
Pl_109410hypothetical protein PHYSODRAFT_339346

Sequence
2530 bases(100 bases per row)
CTCCCGAAAAGACGGGATCACTATTTCTTGTATCCTGCTCGAGCATGGCACCAGATGATAATTGCCATTTTGGTAGCCAACGTCGCTGCCTGGTTTGAGA
CGCAGCATAGCCCGAGACTGGCAGATTCCGGACGAAGCACCATCATTGGTTGAGTACTCACGCATCGCAAAGCACCCTCCCTCCTGCGTTATATGATGCC
ATGGACCCGAATGTGGGTGGTGACCAGTCCAATTAGAGATTCCTTCGGTCAAAACAGCAAGTCCACTAGCTGTCTCAAACTTCTTGATCACGGTACTAGT
GGTGATGTTGATACTGCCAGATTTGAGGTGCACTGTTACGTGTGATGCCAAGGTAAACACATCCTCTGAGCGTCGAGTTACGATGGAATCCTCGCCATCG
GGGAAGCCTCCGGCCGTGACAATAGACCACAGCGCTGATGAAACCGCATCGTTGGTGAACGGTAGCAATTGAAGGCGGACAAACTCCACCCCTTCGACTC
GGTTAGTTTGAATAATATTGGTGTCTGTCGTGGCCACGGACTGTTGCATCAGCCTGAATGACTCTTCCATCTCGAAGAACCGGTCGTCTACTCTCTTCTC
AAGCACATCAAACACATTAGAGTTGCTGAAGCGAAGATGCTTCCCCGTCCCCATCTCGATTCGAAGCGCTTTCTCAGTCAACAACATTTCTGCCTCCTGG
TCATGTGAAGCGCTCAACAGTGTCTCGAATGCCTTCCTTAGACTCACATATCTCTGTAACTTCCTTTTCAACTGTTCATTCTCGTCCTGAGCCTCACGAC
ATCGCTTCTTCTCCACCATAGCCACTGCTTTGATTCTTTGTTGTTTGTGCAACATATCCGCCCCAGCAGATTCCCGTTTCATCTCTAAAAAGGCTACGCG
AGTCTCCATCGCCTGTGTCTGTTGTCGCAGGGACTGCAATTCATCTCTGCGCTTGATCCACGACGGATTCGTGCGCTTCTTTTGAGTAGGGACTCTATTT
GTTGAATTAGACGATACAGTCTGTGCTCGAGATTCACATACAACCGATTGCACGTGGTCGAGAGCCTCCATGTCGTGGAGAAAACACTCAAGCACATTTG
GTGTGGTCATTCGCACTGCGTCGACGTGAGCAAAATCAAAAGTCAATTGCGACCACAAAGTTGCCTTTGATTATGGCAAACTACCAACATTCTTGAAATT
TGACAATTACGATTCCATGAAACTATTTAGGCTGCCTAACAATATAATCGTTTCGATTGGTCAGTCGGATTTGCACAGAGTCTGGCCGACTCGCTCTTCA
AATCGATCAAGTCGACCCAAACCGATCAATCCGATTCAAATCGGTTTGGCTGTATAACCTGCGATACATTATTAGTTAAATTTTATCCCTACAATAAATT
ATAACAGGTAGTACTGCAACAATCGAATAATCGATATTAGTCGAATCGATCGACTCCGATCGAGTCGACTCCGATCGAGTCGGTTCTGTATGTTTATCAG
ATACTAGATCTGGTCCGTGGCCAATTCTTCCCAACTTGGGAAGAATCTCAAACACTCCCCTACAGTCAGTCGCTCGGGATGGCGGAAGTTGATACCCAAG
GTGAAGCTCTCGGCGAAGGCAACGAAACAGTTCCCGATGTTGGTGATAGCGGCGAAAGTCCTGCTACTGAAAGCGTTTCCAGCTCAAGTGAGCACAGATC
GAGTAAGCGTTCCGACATCTGGCAATTCATTACGGACTTGGGCAATGGTAAATATTCCTGTAAATGTTGTGAACGTGAGGATAAAATGCAGACGTGGAAT
TCGAAAGCCCACTCTACAATGCGAAAACATCTCAAAACTTACCTCAAAGCAGAGTACTGCAGTGACCACGATGTACCCATGTCTAGACAGACAGATCTAT
TGTGTTACGGATTTGAACGGGTAGTGAAGCAGCGCGTTGAAAGTGAGTTTAATAAAGCAGATGCGGATAAAGCTCTCGTTGGCTGGATCGTAGCGAATGC
GCAACCGTTTGCGCTCGTTGAACAGCCCAAGTTTATAGCGTTTTGTGCAGAGCTTCAGCCTTTGTACAAGGTTCCTGTCCGACAGACTATTCGACGTCAC
ATTATCCAGCGATGGAAGCTGGAGAAGGACCTGGTGCGGAAAACGATCCTTCGATGCCTCGTCGTGCAAGACAACCGTGCAAGTCGCACAAGCATTACCA
CCGATATGTGGACCTCTGCGGCAGGCAAAGGGTATATGGTGGTCACATTACATTGGATTGACAAAGATTGGAACCTACGTAGCGTCATTCTTGGCTTTTT
GCGGGTTGAATATCCACACACAGGTCGTCGGCTGGCAGACCATTTGCTGGATGTAGTAAAAGCAATGGATGGAGCTCTTTTACTCTCAATTTGGGCAATT
ACCACGGATAATGCGACGAACAACATTAGTATGGTGGACTCTATTAATGACAAGCTACCAAATGCAGTTGAAGAACACATGGAAGCTACTATGTCTTCTT
CAGCCGCAGCTATGACGTTGGAGTCAAGCC