Description :
From Genome Similarity Track
Location :
Scaffold_62:2573- 3669
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_62-snap-gene-0.24ATP-binding Cassette (ABC) Superfamily

Sequence
1096 bases(100 bases per row)
GTAGAGCCCGTCAATGCTGACTTGCGTGAACAAGAGCGTAGTGGTGAAGTGCTATCGGTTCAGCGTCTACGCAAAGTGTTCTCTGTGCCTGGCGGCGAGA
AGGTGGCGgTGAAGGGTTTGAATCTTATCATGTAcAAGGATCAGATTACTTGCTTGCTCGGCCACAACGGAGCTGGCAAAACCACGTTGATCTCTATGCT
GACTGGCATGATCGCTCCAACCTCAGGCACAGCAACGTTTCAAGGATTGTCGATTACAGAAGACATGGATGCCATTCGCGAGTCACTTGGCATCTGCTTC
CAACATGATGTTCTCTTTTCAGAGTTGACGGTGGAGGAGCATTTGATCCTGTTTGGTCGTATCAAGGGATATGTTAacGACGAGCTCAAAGAAGTCGTGG
ACCGTCAGATCCGCGAAGTCGGTTTAACAGAGAAACGACATGTGAAGTCAGCAGAATTATCAGGAGGAATGAAGCGCAAGCTctCCGTAGCTGTCTCTCT
TTTGGGAGACAGCTCACTAGTGTTTTTAGATGAGCCAACGTCGGGTATGGATCCGTACAGCCGTCGCAGCACATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGCCGGCTACAACTTGACTTTGGTGAAGG