Description :
From Genome Similarity Track
Location :
Scaffold_573:25721- 26847
Transcript NameFunction/comments
Phyta_totarag9370hypothetical protein

Sequence
1126 bases(100 bases per row)
NAttacacctggtagcactttgTAGTCCGTCCAACGACCGACTAACTACACGTTCGCATGGAGTCTTACGGACATGGGCAAGAGAACCTTCCGATGGAGG
GAAGTCCAACTTCGTctgcaacgcacattgcGCGTGCAGACTGTCCCCACCTGTCGGACCCAGAGTGGGAGGCGCTCCGACGACTGTCAACAGTCATTGC
CGAGGCGGCTGTAGCGGCGATGCTACGCACGCTATCACCGACAGAGCAACGCGGTGTTGTTCTAGGTTTTAACGTTAAGGAagagcgagatgctgctgcc
tctacgacggcgtcgtcccTGACGACACTGCGATCGATATTGCTAAGGTTCCACGTGAGCAACTACGTGGGAAAAGAGGGCGAACCTCTTCTCCGTTGGC
TTGTCGAAGTTGACACAGCTATTACGGCACGACGTATCGCCGAACCGTTGTCGAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCAAGGAGTTG
GGCGTAGATCCGTAAGGTAGGTGTAATGGATGCTGGGGTACGGATGCCGAGTCACGGACCCTACATGCTTCAGCACGTACGAGGATTTCAAGCAGGAGCT
CAGACGAGCGTTTGAGCTCCCGCAAAGCGAGTTCCGATCAAGACAGATttcctcgatctgcagcagggcAAGCATGATGTTCATGCTTACGCCCAAAGGG
CATGGTACTCGGTCTCGAACATCGTGACCAACCCGATAGACGAGGCGACCAAggtcgtcacgttcatgaaaGGCTTGGAGGATGAGCTGGTCAAAACCTA
TCTCTTCCGAGAGTAACTGAGTACTCACGAAGCTGCGATCGCGTTCGCAATGCAAGAAGAGTTTAGCTTGCGGCAGGCTAAACTGCATGTGAANGTGAAG
CAGTCATGCGTGTCGACATTGGACACGCGTCAATGAGGACTGCAGCCCCTAGTGAGGCACTCTCACTGCAACGAACCAAACCTTGTCATCCTAAACGTGA
CCTCGAAGAGAGCGGACTCTCTTCATGTATTGGTAGACTCAGGTGCGCCGAACAACTttgttcgacagcaaagttTATCAAGTCttgacttcgaggaggt
gcaaaCACCTCGAAGCGTATTGGAAG