Description :
From Genome Similarity Track
Location :
Scaffold_571:2572- 5370
Sequence
2798 bases(100 bases per row)
TNNNNNNNNNNCCAACGTCGATCTTGGATACCAGCCATGGATTAAGTAAAACGGGGTATCTTCACAGACGCTATCTTGTGCCGTTTTCATGTCAAAAGTC
AGTCTTTTCGCATATTCATTCCAATCCTTCTGATCCNNNNNNNNNNCGTAGCCTTCAGCAATCGCTTGTGCAGTCCTCGACGAACTTTCTCTCGCGATCA
CGTAATCTGAGAATAGATCCACCCACAGCAGTAGTTNNNNNNNNNNCGACCACCTGAGATGGATATGTATCCTGTATATTACCCGGGGATTTGCCGCGGA
TCGCGGGTAAAGCTTTCCCAGTTGTGCAGTCCACGCATTGCTAACATAACGCTGGATACTCCGATATGTACCTCTCCAATGGAAGTAACACCTGATACGC
TGATATGTCCTCCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGCCCACAGCAGTAGTTTGGTGCTTCCTTTAAATGGCCGTGGCAGGGACGGGA
TGTGATGTGATCCATTGGGATCACCTGAAATGAGTATGTTACCTGTATATTCCCAGGGGATCTACTACGGATCGCGGGTAACNNNNNNNNNNTTTTGGAA
GATCGGGGGCTGAAAAAAAGCAATCCATTTTTGACGACTTCGTAGTCTGGAGCGATCCGAGCGCATAATTCTGCATCTCCGGCGTTCAACTNNNNNNNNN
NCCCTCCAAGCTCTTGTGGTAATGTTGAATAAAGCCCTGTTGTAACAACTCTGGCACACCCAGACGGACCATCTCCATGCAATCGTCCGACTGTTTAGAA
GATNNNNNNNNNNCTGCAAGAATTCTGGTACAGCCAGATGGACCATCTCCATGCGATCGTCCGANNNNNNNNNNCTCCCGGTCACCAAGGGTGACCACCT
TCCAAGATCGTATGGTAATGGTGCATAAAGTCCTGTTGTTATAATTATGGTACATCCAGACGGGCCATCTCCATGCGATCGTCCGACTGTTGGAAAGATC
GGGGGCTGAAAAACAGCGATCCATTTTCGTCGACATCGTAGTCTGGAGCGATCCGATCGCATAATTTTGCATCTTCGGCGCTCAACTGGGTTAAATGTCC
TATAAGATATTCCTTCAGGTTGGCGATCCANNNNNNNNNNTGCACGGATCGTGTGATTGCTGTCATCTTCACTACACAGTCCACCTTTTTTGGCANNNNN
NNNNNTGGCATGAACAATTCGCCCAGCCGGTTTATTGATATCAAATCTTGTAACTCTTGATCTGACGTTACGATGGNNNNNNNNNNTGCTGAGCGGATCG
TGTGATCGCTGCCATGTTCACTATGCGGTCCAACTTTTTTGGAATAAATGATTTGCCTAGACAGTTGAGTGATATCAAATCTTGTAAATCTTGATCTGAC
GTTACGATGGNNNNNNNNNNNNNNNNNNNNNCTACGCTTTGGTTCCACTCCCACTTCAAATGTAATAACTCTTGTTTTGGCCATGATCGAAGTTTCTGCA
TCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACAATCGTCCATTCTGGTAGTTTTCATATGATCGCTATACGACCCACTCTTCCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCCATCGAAGCTAACATTCAATAGGCTCTCATCCTTTTCC
ACCGTGGGGGGTGGCATGGTTACAATATGTTTAGTTTGCTTCTTTTGGAACGATCGCGATCAACACAACATCTACCTCTTCTCGAGTGGTTATGCTAGCT
GCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACACTTTCAAAATTCGAAGCA
AGGCTAACACCTCGTTCTCCACGATACCACAATTATCTTATTTGGCTTCAGTGTACGGCTCTTGAATGCCACCGGCCAGTACACACCAGCATATTTCTGC
AGCAGGGATGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCATCGCATCACGATAATCTATATCATTAATCTCAATAAAAAGCTGCCTCTCTTAGCTCGTACAACACAGATGCNNNNNNNNNNA