Description :
From Genome Similarity Track
Location :
Scaffold_481:2571- 8892
Transcript NameFunction/comments
g15962.t1hypothetical protein
g15963.t1hypothetical protein
g15964.t1POM74321.1 RNA methyltransferase, TrmH family, group 3, variant 1 [Phytophthora palmivora var. palmivora

Sequence
6321 bases(100 bases per row)
AGCTCTGCCAAGTCTTCCTGGATCGACTGCGACGTGAAGCTGGTGATCGAGTCGAGGATAAAGCGCCGCCTCTCCATCGACAGCTGCGTGTTGATCTCCA
AGAAGCCCGAGCTCTGGTGCTCCATTTTCTTGGTGAGCTGGTGGAACATCACTTCATATTTCTCAGGATTCGCGCCTTTGTCGCGCTTGGTGTGTGGCGT
CAGGAACTCAACAAACTCCTGAAAGTCGATCTGGCCGTTCGAGTCCTTGTCCAGCTTGCTCACGATCTGCTCAATCTCCATCGTGTCGTTCACGATGCCA
ATGGACAGCATGGGGTCCTCCAGCTCCTCCACCGAAATCTTGCCGGACCCGTCCGAGTCCAATGCATCGAACCACTGCCGCAGCATGCGCTTCTGCTCCC
CTGAGAACTGGAAGCGCGGCTGCTTGGCGTGCTTGGTGAGCCACGCGTTCTGGTCCAAGTGCAGCAGCTCCTCCTTCAGCGCCCGATGCCTGGCAATGAC
AGCTGCTGACGGGGCTGCCGTCGGGTCCGGTGCCGCTTGCCACCACGCGCCCTCTATCTTAACAGGAGGCTTCCTTCCTCCATCATGCCGAGCCATTGCC
AATGCCATTGCCATCAAGCTGCTGCAGCTGCAAATATAGTGTAGCCATGTGTCCGTTCTTCCACTTAATAGGGAGCGAACCCAGTTGTGACTCGAAGTGT
TTTTCTTGGTGACCACAAAGATTGTTACTCTCCTCCTTCAAAATGAGCTCGACAGTCAAGCGCGACCGGGAGTGGGAAGCGTCGGCTTCGGACGGCGCCA
GTGCGGCCCCAGATGCCGACGCGGACGTGAAGCGACCCCGCATCTCTTCTCCACCGTCTTATCTTCCATCTGATGCGAGTTGTGCCCATCAACGCCCCGT
ATTGACGTCAGGGCAGCTCGACGAAGCGCACCCGATGGCTGTTCTGGACGCGATCCGCGCCAAGCTGCAGAGCACCTCGGACCCCCATTTACAGGCCCGT
CTTTTGTTACAGTACAGCGCAGCCGCAGCCTCTCCAGGGGCCAAGACGGCGGCGGCCATCGACTTCCTCTTCTCGTTCCTGCAGCAGAATCAGACACAGT
CGGAGACGCAGACGGACGGGAATCAGAAGGACGCCGGCAGCAGCGGAGCCATCGTCGTGGGCGCCATTGTGCGTGGACTGAGGCAGTTATTGGCAGTTAA
GGCGGCGGTGGTGGAGCCGATGATCCAAGTGGATGCCATGGGCGAGCAGCTCATGCAGTGCATGAGCGTGGGCGAGGACTTTAAGCTCAGGAGGGACATG
ATGCGCATCGTCGTGGACTGCCTCATGCTCACCAACAAGTACAAACAGGTGGAGACGCTGCTGCACACTTGCGTGCAGGACCACGACGCCGGCATGCAGG
CCATTTGTCTGCGTGCATATCTCAGACTGCACAATGCAGGGCGCTGCTTTGCTGCCGAGTCGTCGTCGATGGAGGAGGCTCAGGATACTGCAGCGAGCCA
TTTTGACCGCTTGGCGGCGTTTGTTCTGTTTGCGCAGAGTGAAGAGGTGAGAGTGCTGGCAGCGCAAGTGCTCGTGGCGCTGGCAGATATGCACCCGCAG
CACGAGATTGCAACCAGCAAGTTTTTCCCGACGACTACGAAGGCGCTGTTCTTTTTGCCTGAGAAGGTGTTTTATGTACTGTGTATGGCGGGTAATGACC
CGTCAGAATCGGTGAGAGTTGAGGTCGCCCGGTGTCTGCGAGGGTTTTCTCGTGTACTCGCGAGTGAGGCCGTGGAGCATGCCGTGCTCAAGACTCAGAT
CGACGAGGCTGTGGTGGATGTAGCACCTGAAGTTGTGGAAATGAGCACCCGCCGCATGATGTCTAGCGGTGTACTGCTGTCACTTTTAGAGGACGTGGAC
GTGGATGTGGCTGTTGAGGCCTCGCGTACGATTGCCCGATTGAGTGAAATGGCGATGGCTCTTGACGCTGGCATTGGACGGTGGAGTCGGCGAGCTTTAG
AGCGCGCTATTACGGCGCATTTTGACGTTCTCCCGCATACAAGTGCGTCGAGTGCCTCACTCCTGTGTCGAGTGCTAGTGAACTCTTTGGGTCGTCTACT
GGTGTGTCGGCAAACGCTTGACACGAAGACGGACTTCCCCATTTCCAGCGCAGATTTGAGCTGTTTGATTCGCAGTGTTGATTCTAACGCGGGCACGATC
AAGCCCGCAGCCGTCGAGGTCTTGCTCGTTGTGCAGCGTTGCGACTTGTCAGGTGCTTGGGCCGTCCAGCGCCTTGTTGACTTTTTGCTGGAGACGGTGG
GCTCTACATCATTTGAGAACCCTTCGGTAGATGGTGATGACGATAATTCGGACTGTTGGGACAAACGGCTTGTTGATGCAGCGCGGGACCTGGGAAAGAA
GTGCGCGAAGGTGCTTCAAGCTGACGTTGCGTTAGCAGACCTCGTGCAACGAGAAGCATCTTCCCGGCGTAATAACCGGCCTTCTCTTTTGAAAAGAGTG
TGCCAAGTCTTACTTGGCCGTACCGAAAACTCAAACGGCGACAATTCGGAGACTGTTGGCAAATCGGAATCTCCCTCTGCTGGATCTACCTTGTTCTTCC
TAAAGAGCCTGGCCAAAGAAATTCCTCGTGCCACCCCACCCTCTTCTTTCAGCATCTCATCTCAGGCCGCTAGATCTATGGATGTCTTGCGTACGCCTCC
AACCGACGGAAATATTGCTGTACACCTCAAAGCGGTAAGGTTCATGGTCCCTCATTCTCTACAATTTCTATTGAGTGCGACTAATCGTCTTTTGCTTGTG
TATCTACGTACAGATCCATCGACTTCGCTCTGCTTTCGCTGCAGATGATCTTGACGCTTGCTTCCGTTTCGCGGATGTTCTCGTTCGTTTGCGTCAGCAT
GTGCTTTCGTTTCCTGACGCGTCATCTGCACCAGCACCGATTGCACACAAGTATGTATCTATGCAGGCAATGCTCAGTACCAGTCCAAGTGTGAGTTCTG
GTCACACCAGCAGCACTAGCGGGGGCAGTCAAGACCAGAAAGAAGCGCAAGCCTTTGCCGGGTTAACTCTGCCCGCGGATTTGCAAAACGGCTGCCAAGA
GATGGTTGACGTTGCCTCGGGCGTCTACGTCAAAGCATTTGCCCTCAGTTCATCGCCCCGCACAGAATTGCTACAGGTATTCCTTGTTCTCATCTGACTG
TAGCCTCTAAACTGACAACGCTACGTGCACTACCATGTAGTTGATTTTGCTCGGTCGCGTGGGACTCGTGCTCGCACTGCTGCAAAACACGACGGACAGT
CTTCTCATCATTGAGAAGCTCCGGTGGGTATCCAAAGAAGCAACCCGGCTGCGCTTCCTTGTCAGTGAAACGCAGCACGAAGGAGATGTTTGGCTACCGA
CTCAGTTGCTGTCGGACGTTAGCTCGCTGGACGATCTGAAACGTGCCATCGTGGCTATTATTCGTAAAGCGTGGCCTACGGCGCTCATCAAGGCTGCTAT
CGCTCGTTGTACGTCTGCGACCAGCGTCAGCGACGTTCTCTGCCGACGTCTTGCTATCGCTCAAGCATCAATCTTAGAGCCTACTGCTATGGCAAGCGCG
AAGCCAGATCCCCGAGAAATCACAGCGAACTGGCCGTTTGAGCAGCGTGTCCGTATCTCATTGACGAACACGCGGGACATTTCTCAGGTGTACGTCAAGA
GTGTGCTCCCCAATGGCGATGTGGCCTACCACCATGTGCCAGCTCGATGCATCCGCACTCAAGGACCCCGAAAGCATTCCGCCGAACACACAATCACACT
CACAGTATCACCATTTTCGGACCCGACGGCGTTTACCGTGGCAGTGTGCCTCGGCCACCCAACGTTGCCTGGCAGCGTGAAGGTAAGCTGACCGACCGCA
TATTTTTGATATGGGGTCGAGGATTGACTTTACTTTGCTTCGACGTTGTGGTGCGTAGCCAAACGCCCCTGGATCCGGCGAGACAAGTCCGATGATGTTC
AAGGAGATTTCGGCATCAGTCCGCGTACCAATCTTCCACCGCACAAGTTCCACACTGAGGTATGCAGGACGTCGACAGCATGATTAGACTGCGCCGATGA
GTAACTTTTTAACACACCCTAGTGGTGCAAGAGCTCATAGAGCAGGATCGCCGAAGCGACGCTGACGTTGAGCGAGTCGACGCGCGTGTCTTCGTCCGTA
GCTTGGCCTGTGTCGCATTAATTAGAGTTTGAACACAACCGAAAGAAAGTTTGGCAAACACGCGCGTACCTGGGATGATGACGATGTCCTGGCAGCACTG
GCGAATTCCCTTGCGGAGACCGCGGTGCTCGTTGCCCTGTTTGGAGTAGCAACAAGCGGTGGTGAGATGCATGGAATCAACAACTATCGCCTCCACGCAC
GAGTGCACGTACCATGACAAGGATCGTAGGCTGGTCACCACCTTCTGGGAGCTTGGTGGACGTAATGGAGTTGGGTCCGCTGCTAGCACCAACAACACGC
CAGCCGAGGTCACCACTGATTGCTAGCATTTCATGCAAGTTCCTGGCCTTCAGCAATTTATTCTGCGCCATCATCTCCGTCAATACATGTACCAGCATAT
CTAAATCAAACATCAACAGCTACGAAAACGTACGTTGGCGACCAAGACTTCCAATGCACCTGCAGAAGATCGCGACACCTAAACGACAGACACCATCAGA
CAACTCTCACCCAACTCGACCTCCCCCAACCCAACCAACACACCGCAGGAGACAATGGGGCACTGTTCCGGTCGCTCACAACCACCGCCGCACATCCCAA
GAAATGCGCCGAGCGGAGGATAGCTCCCAGGTTCTGCGGGTCATGAACCTCATCCAGCACCAAAATCACCGGCGAGCGCTCCGACTCAGTAAACACTAGC
CGCCACACCACAAAAGTTCAATAATTGCACTCTAAATCCCTCAAAAACACTTCCAACCTGAGGGTTCAGCGGGTGCAAACTCCTGCAATTGAAGTGCAGC
CGCGTCCAGCACGACGCCCTGATGGGGTTTGTCTCCCGTGATATGATTCAGCATCCACTTGCTGAGCGTATGCAGCTGCACGCCCTTGGCGTCCGCCAAC
TCCTTGATGCGCTCCAGCGCCTTCATGTCGGCCGCGCTCTTCTTCTTCGGGGCCCGCTGCCCATCCATGGGTACGCGCTCCTCGCGCACGTACAGCGCGT
GGGCATTTCGGTGACCGCTCTCCAGCGCCTGCAACACGCTGTGAAGGCCGTAGATACCCTCGCCCGCCAGCTGCGGCACGTCCGCGCCGTCGTTTGTGCG
CGTGAGCGGAGGACGGCGCTCGTTGTCGCGCCAGCGTCCACCTCTTGAGGGGTTGGGGCCACGGGATCGTGGCGAAGAACGCCACTGGTTGTCCGAGTAC
GAGGATGATGAGAAACAGGCCGAGAGCGAGCGAGGAACAGCAGACGCGCGACGCAGCACCCGCGTGGCTGACAGCATAATCAATGAGGTCAATGTGCTCG
GCGCGGAAAGGACTAATTTAATAATATTCAATTAAAGATCAATTGGGGGGGGGGGTCGACCGATCCAGCACAATTTGTTTGGGGTTATGTGACCCAATAA
GACGCATTTACGTATATTGGTGAATAATATTCATCCATAGACAATATTCATGCGGCGGTGTTCTCTACGTGCCGGACATGAATTCAAACTGCTGTCAGAT
ACTGAAGATGGGCAATTGCCTTGCACGTTTTTCATGGGTAAGGGCTGCCAAGATGCCACCAAAGACGCTATCCTGAGCGCTGCTGGCATCGACTCCTGCG
GAAGACAAATCGCCTATGCCCTTGTGACTCAATCGTGTGTGGACCCCACTGCTTTCTTGTGGCACAAATATCTCGGCCATCGTAACTTTCGTGTGATGCA
GATTCTGTTGAGGCCTCAAGTGGCTCCAGAACTGATGTTCATCAACCATCAACGACCCCCAAACACTTCTGCTTATCGAGCCTGTTTGCTAAAGGACCAT
TGCGTGTTCATAAAAGATATAACCAATGCCCCGTGTTACATCGCGGGTTACGTCGATGAACTTTTGATCATCTCACCATCCAAACAAGTCGGTGCTCGTG
TCATATCGGCATTGCACTCCGAGCTCGACATGATCGTTCAGGGGAGTACCGCATCTCATTGGCTGGACCATTATAAGGAACTGAGCCAGTCAATCTTCAT
CGCCCAGAAAATCTAGGTCACTAAAGTGGTTGCTCGATTCTCGATGACCCAAAAAGCACTCCCATAACACAGAAGCTGAGCAGCACGGACTGTCCTAGGG
AAGACGGAATGCATACATTAT