Description :
From Genome Similarity Track
Location :
Scaffold_14:25707- 26967
Transcript NameFunction/comments
Physo_131005hypothetical protein

Sequence
1260 bases(100 bases per row)
CCTAGCTGAAGCACCCCTTCAATCACGGTCTGCACGCTTTTTTCAATGACGGTGTAGTTGCTTCGACTTTGTAGAGGGTCGAACATAAAGCATGTCGCCG
TCTTCGTGCCCTTGGCGACCGTCCTGTCGATTAAAAACGCCATCCAGTGCCGCTCGATGTGAATGATTCCAATGACACGCTTGTTCTTAGGGTCGCTGGC
CCCGAATCCTGCCGCGGTCCTGCGTTTTTGCTCCGGCAACGCAAAGTCGTGATAGCTGGGGCTGATGATGCCTACGTCCGGGTAAGCGTCGCGCAAAGCC
ATCAGCGACACCAAGATGGACGTGGTATGCAGCCACAGATTCTCACGGAAGTCCAGTAGTTGGTGTCCGTTCACACATTCACCGGGCACGCGATTTACGC
TCAGATTGAGCGTTTCGACGTAAGCCTTGTGCTCGTTCTGCAATACACAAGATACTTTGTTAGTTTTGGCGCATCTTCAGTTCAAATGCTGTGAATTGTT
TCTTACCTTTGTGGTTGCCCTCGTGTCCGTGAACGGCTCGCGAAGGTCTGCAACACGCCTCTCCACCTCGTCAATCCACTTTGTAGTGCGCATCACCAAC
GCGAATCGCTGATGCGCCTCCAGGATGCTTGCCATAGCGTCCAGCTGATCAAATGTAGCGTAGCCATAGTCTGGCCAGTAGGCAAGAAGGTCGATGTCCT
GCCTTATCTTGATAGCGTCAATAGCCTCCGTCACAATGGGTAGCGGAGGGATACCCTTGATAAACGGAATGTCTTGGTCGATCTTGAAGGCTCGGACGGA
CAGCGGCCCGGTAACATCAACTTGGGGCAGTACAAGCGCGTCAACCATAGGCTTTGAGTGGAATAGACTGTAGGGTCCGTCAAGCAAAGCGGCAGCATCA
TCGAATGAAACCAATGTTCCCACTTTTCGTTGGCGGTACTTAGCTGCCAGTTCCAATGCAGCTTCACGGTCTTGTTTAGCTTAGGCACGCTTTCGCTGAG
CCTTGGTCATTCCATTGATCACTGGACGCTCCGCAAACGTCCACGTGACTGCCTTTGGGCGTCCTTCTGACGGCTTTCTCGATTCGGCGGAGACTCGTGT
GGGTTCGGTAGAATCTTGTAAGGTTTGGTCGGAGGGTGTAGCGTTGCCATCTTCCTCTGCTTCCGCACCCGTTTGAGTTTCTCCATCAGCTGCCACATCG
ACTTCAACAGCAGTGCTGCAGGACTCCTCCTCACTTCTTTCGATTCCGCCAGTATCTTCA