Description :
From Genome Similarity Track
Location :
Scaffold_18:257039- 260182
Transcript NameFunction/comments
Phyci_63788hypothetical protein

Sequence
3143 bases(100 bases per row)
CGACTTCCGCGTCGTGCCGCTGCCGGCCACGCGCAGGCAGCGCGGCCACCAGGCCGGCCCGGAGGCGCCGCCCGAGTTCTGCTCCAACGTGGTGATCACG
TCCAAGTACACGACGTGGAACTTCCTGCCGCTCTTCATGCTCGAGAGCTTCCGCAAGCTGGCCAACGCCTACTTCCTGCTCGTGTCCATCCTGCAGTGCA
TCCGCAGCATCAGCAACACGAACGGCCTGCCCTCGAACCTGCCCGTGCTCGTCTTCATCCTGGCCGTGGACGGCGTGCTGGCCGTGATCGAGGACCGCCG
CCGACACCTGGCCGACAAGGAGGCCAACTCGGCCCAGTGCCACGTGCTCAAGGAGACGTTCACGGGCACCGCCGACGCGCTCAACCGCGCCGGCGGCGTG
GACGACCCGGACATCGCGCTCATGCACTGGGCCGCGCTCACCGTCGGCTCCGTGGTCAAGCTGCACAACCGAGAGACGGCCCCCGCCGACCTGCTCATCC
TGGCCGTGGCCGAGCCCAACCCGAGCGAGCCCGCCGGCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACCAACCTCAAGCTGCGCCACGCCTG
CGACGCCACGCTGCACGTGCGCACCGCGGCGCAAGTGGCGGCGCTCGGCGGCCAGCTGCGCTGCGAGAACCCCAACAAGGCCATCGGCCGCTTTGACGGC
ACGCTGTCCGTCACGGAAGGCACCAAGGCTGCCGACTCGCACCCGCAGCCCATTGCGATCAAGAACGTGCTGCTGCGTGGCTGTCAGCTGCGCAACACGG
ACTGGATCTACGGCCTCGTGGTGAACACCGGCCCGGACACGAAGATCATGCAGAGTGCCACGGCCACGCGGCCCAAGTGGAGCTCCATCAACGAGACCGT
AAACAAGATGATCATCTGGCTGTTCCTGCTGCTGTGCTTCCTGTGCATCATCGCCACGACCGTGCAGGTCATCTGGCTCAACAGCAACATCGACGGTAGC
TGGTACTTGATCTGGTCGCCAAGCATGACGAGCCAGTGGTTCATTGGTTTCGGCTACTACTTCCTGCTCATGTACCAGATGATCCCTGTGTCGCTGTACG
TGACCATTTCGATGGTGATGTTTGTCCAGGCCATTTTCATGACCTGGGATCTCGACATGTACTACGAGGAGGCAGACGTGCGTATGATTGTTCGTTCCAT
GGGACTCAACGAGGAATTGGGCCAGATTTCGTACGTGTTTAGCGACAAGACGGGCACGCTCACGTGCAATGTCATGGAGTTCCGCAAGTGCTCCATCAAC
GGCGTGTCGTATGGCACAGGTATGACGGAGATCGGCCGCGCCGCGCTGCGCCGTAAGGGTGTGGTAGTGCCAGCAGAGACAGAACCGGACCCGGCTTCGC
GCCGCGCCAAGGTCCCGTACGTCAACTTTGAGGACCCGCGGCTGTTTAACGTGCTGGAAAGGCCTATCACTGACGACACGCCAAACCGTGAAGCCGAATT
TTTCCTACACCTGAGTCTATGCCAGACTGTTATCCCGGAGACTGTAGAGGGCAGCTCTGAAGTCCGTTTCTCGGCCTCGTCGCCTGATGAACAAGCGCTG
GTGTCGGGAGCTAAGTTCATGGGCTTCAGTTTCGAATCTCGCGGTCTGGGCATTGCTCGTGTTCGCGTGAAGCGTCCGGAATTGATTCGCCGCTACGCGA
ACGGTGCTACAGGCTCCAATGTACTTCTAGAGTTCAAGATTCTGGATGTGTTGGAGTTTACGAGTGACCGTAAGCGTATGTCAGTCGTGGTGCAGTACCC
CAATGGAGAGTACTGGGTGCTCACCAAGGGTGCTGACAATGTAATCTATCCCATGCTGGCAAAGGAGAAGAGTGATCCCGACATGATGAAAGATACCATG
CGTCACCTGGAGACGTTCGGTGACGATGGTCTGCGTACACTCACGATCGCTCAAAGGCGTGTGGATGAAAAGGAGTACCTCAACTGGAGTGCACGCTTTA
AGGAAGCCAACTCATCATTGGAAGAGATTGACAAGCGCAAGAATGGCTCGCCTAACGAGATCGACAAGCTAATGACGGAGATTGAACATGATCTGGAATT
GCTAGGCGCAACGGCTATCGAGGACAAACTGCAGAACAATGTGCCTAGCTGCATTGCTAACCTCATGCGTGCTGGCATGCGCGTTTGGATGCTTACTGGT
GACAAACAGGAGACTGCCATCAACATCTCGTACGCTTGTCAACTCATGGATAATGACATGCAGCAGTTTGTCTTCAACTGCGATCTGTATCCGACGAAGG
ATGCTATCCTTTCGCACCTGACAGAAGCGAACTCGCAGGTTCAGCGGGGCGGTGGCCGCCACGCTGTGGTGATCGACGGTGAGTGTTTGGAATTGACACT
TGCAGATGAGCAGTGCCAGCGTGAATTCTTGTCGTTGGCGATGGCCTGTGATGCAGTGGTATGCTGCCGTGTGTCACCCAGCCAGAAGGCTGAGGTGGTG
ACTTTGGTTCGCACTGCCAATAAGAAGGTACGGACGCTGGCGATTGGTGACGGCGCAAACGATGTGGCCATGATCCAGCGTGCACACGTTGGTGTTGGTA
TCTCGGGACAGGAAGGTATGCAGGCTGTGAACTCAAGCGACTACGCTATCGGCCAGTTCTACTTCTTGGAGAAGCTTCTCTTGCACCATGGTCGCTTGAA
TTACAAGCGCATGTCGATTCTTGCGGGCTACATGTTCTACAAGAATATTGTGATGGTACTGGCACAGTACTTTTACATGTTCTGCACGGGCTCATCTGGT
CAGAAGTTCTACGGTGAATTGGGTTTCCAGCTGTACAACATTTGCTACACGTCGCTGCCCATCATTGTCCTCGGTGTTTTTGACTACGACGTGCCTTTCG
AACTGAGCAGGCACTTCCCCGAACTGTACCTGGTTGGCCCGCGCATGGAACTGTTCAACAACTACACCTTCTTTAAATGGATCTGCAGTGCCGTGTACGA
GTCGGCGGTCATCTTCGTGTTCGTGGTCTACGCATTCAACGAGAACTTCTCCAACGCTGGCAGTGCACCAATGGTGCAGTACGGATTATTAGCATTCACG
ATGGTAGTGTTGGTTGCGAACATCAAGCTATGCTTGCTGCAGA