Description :
From Genome Similarity Track
Location :
Scaffold_658:257- 8245
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_658-snap-gene-0.5GBF1, ArfGEF protein of the BIG/GBF subfamily
Pytir_DAOMBR486maker-pir_contig_658-snap-gene-0.6ADP-ribosylation factor guanine nucleotide-exchange factor 2
Pytir_DAOMBR486maker-pir_contig_658-fgenesh-gene-0.1Liver stage antigen

Sequence
7988 bases(100 bases per row)
GCAGGAAGCGCAAGCAAGGACGCATCATGACCGCGCGTGCGCTGCTGCTGGGCGACCTCCAGCGCGTGCTGAGCCTTGCCAGGCGCCGCTTCGGATACCT
GCTCGCGCCCGACCGCAAGCGTCAGTCGCAGGTGCGCGCTTCCGCCACTTTACGATGCGCTCTTGTGCGTTTTGTGAGAGTCTCAGAAATGGCTCGCACT
TTTGGATGAAATCATATGTGTGATCATGTGATGAACGCTCGTTGTATTTGCGCAGGATGGCGGTGAGGCGGCGATCTTCCAGAGCTTTGCGCTGCTGCGA
GCGCGTGTACAGCGCTGCGAAAGTGCGTATTGCTGTTGTTGTTGTGTTGCTCGCTCGCTTTTTTTCTTCGTGTGGCGCTGATACAAGAAGGAAGCTGAAC
TTTCTCGTTTGCGCAGACTTAGCCGAGTTGAACCCGGCGACAGTGCTTCGACCCTTCCTCGACCTCATTCGACACGAGCAGACGAGCAGCACACTCACCA
GCGCGTCGCTGGAGGCCGTGCGCAACTTTCTCGAGTCGTGGCCTTGGAGACTCTTGAAGGACACAAGCGCGATCTCGGACGCAGTCTCGGACGTCGTTGA
TGCTGTGAGCCAATGCCGATTCCAGGAGACGAGCATCGAGAGCGACCAGAACGTGATCGTGATGGTTGTGGACGTGCTACACGCGGTTCTCGCGTCTCAC
GCGGCGCCGTTCCTCTCCGACCACTCGATGTGGCAGCTCGTGGAATCGCTCTACGCACTCAGCCGAGCGTCTCGCAACGATGTACGTGCGCGATCTCCAT
ACGTTCTATCATCATTTGAGGCTGATGCTAAGGATGATATGATTATCTGTTGTATGTTGAATCGTACAAGCAGCGACACATCACGTTCTCGCTGCGCGCG
ACCGCGACCAATTGCCTGCATGACGCAGTGAAATTCATCTTCGCCACGCCGTCCGTATACAGCGATTCGTCCTCCATGCCGTCCGTAGGATTTGGACTGC
CATGTGCTGTAAAGACCGTGGGTTTTCTCTGCCAAAAGTTGCACCAGCGCAGCTCAGGGTCTTCATTCGCGTCGAGCCGACGAGATGTACTGCTGGCGCT
CAGTCTGTTGCATCGCATGCTGTTGTCTTGTGACCCCCACTCGATTACCCAAGTGCCGTCGCTGATGCTATTTATTAAGGACGATCTGTGCAGCGGACTA
CTTCGATTCAGTCGTCTCGGGTAAGGATCATTTGCTGCTGTTGTTGACTAGATATCGCGACTGGTTCGCTTATTCCTCTTTGATTGATGTTGCTATGTTC
TCATCTCGACCGTGTATTTTCCAAACCTAGAGCATGCTCCGATATGAAAATCCCGATCCAGTGCCTCGAGATCATCCGGCTGCTGTGGTCGAAGCTTCGA
CCGGTACTTAAAATGCAGCTCGAAGCGATCTTCAACGGGGTGTTCTGCAACTCGCTTCACTGGACGATCGCAAGTCTGGACGTGTCGAGCCCAAACTTTC
CCAGTGACCCAAACAACAGCAACAAGAACATGCTGACTGCGAACGGAAGCACTGCCGGCGAGGTCAAGGCTGGACGCCGCGTTGATGCAGCAACTGATGA
GTTTACTGGGGAAATGATGTCTTCGTCCCGGCTGTTCGCGACTTCGTACGAGATTCTGGACTGTTTGGTGGATTTGCTCGCTGAGCCAACACTGCTGCCT
GACTTGTATGTAAACTACGACTGCGACGGGAACCGCTCAGATTTGACGCTGAACATCTTCGACTTGCTGTCTCAAGTGGCTCAACACTCCCACAATGCGT
GTCACGAGACGCATGAAGAAGCTCATTTTTTGTGGGCTCAAGGGATCGGAGAGCTAGCGCTACGCGGGCTCTTCAACGCACTCTACGTGGTATATCTAAG
AAGTCAACACAAGCAACCAAAGATGAACTCAACCTCCCCTCGAGTAAACGGTATCAGCATCTCCAGCGAAGAAGACAACAATGACGATGGGCTGCTTGAA
GAGAGCGTTACTTCTCCTCGTGATAGTGCGGGGTTCGCGACGGCGGAGGCGCTATACAAGCGGCGCCAGCGCAAGAAGTTTTTCCAACACGGCATCCAGG
AATTCAATCGGAAGCCGATTGCAGGGATCAAGTATTTGCAGCAGAACACATTTCTTCCGACGCCACTCGACACGAAGTCGCTAGCTGCGTTCATGCGCTC
GCTCCCGCAAGGTTTGAACAAGAACGCAGTGGGGGCGTATCTTGGAGCGATGGGCAAAGACGTGAAGGAGTTCGAAAAGGCAGAGATTCACGAAGCAGAC
ACCATGGATTTTCACCGCGAAGTGCTCACAAATTTTGTCAAATCCTTCAACTTTGAAGGTGAAAATATCGTCGCAGCTCTTCGAATGTTTCTCGCGAGTT
TCCGGCTTCCGGGTGAGGCGCAGCAAATCGATCGGATCCTGAACACGTTTTCGCTGCAAGTGTACGAGCAATGCCGAGACCGTTTCCTGATGGCATCACC
GGACGTTGCCTATCTGCTCTCGTTCAGTTTGATTATGCTGAACACAGATCTCCACAACCCGAACATCCGCCCAGAGAAGAAAATGAAGGTCGAGGATTTC
ATCAAAAACAACAAGAACTACGGCAAAGAGGTGTCTCAAGATCGTGACCTTCCGGATGATTTCTTGACAGAGATTTACAATACGATCGCGAACGACGAGA
TCAAAACATTTGAGGACGGAGGAAAGCACGGAGAAGTGACAAACGATCGCTGGAAGGATCTGCTGAATCAGGCAGAAAATGATCCACGGAACTCTCAACT
GATTGTGCACCATCGACTGCAAGATTCAAGCATTTCCACGCCTTTTGCAGCAATCACAATCGATTCGATCCGAGCGAACACTCAGCACCAAGCTCGTCGC
TTCAAGACCAGAGCAAAGCACTTGATATCGAAGTCGAGTGGCATTGCAACTCGATCGAGGTCGAGATCTCGCTCAAGATCGTTTCAAGATGAAGAGGAGT
ACCCAACAGAGGAAAAGAAAGAGCAACTTGCTGATGGAGACGCGTTTCCTTACAATAATTACTACGCTGGCGATCAGTACGACCGTCACATCTTTGAGCT
GATCCAACCGCAGTTGGTTCGAGCTTTCTCCAGCGTCTTTCAGCAGTTTGCGAACGCATCCAACGGCAAAGATGGAGTGGGCAACAATGGCGATTCATCG
TCTTCCTTGGACGACGACTCGACCCAGACAGCATACTATGTTCCCGAGAAGAGCATGCTCCAACTGGCTTGCAATGGACTCGTGTTGTGCGCCGGTGCAT
CGTCTCACCTGGCGCTGCCAGAGCATTTCAATGGGATCTTCAGCCGAATCTGCAAGTACACGGCGCTGTTCCCATCAGAAGTGTATCCCTTGGGCTACAA
CCGACGAGAAGAAGGTGTGTGGCTGTTTTGCAGCAATCAGAGCGCATCTGTGGCGACAGCGGGGATGCTGAAACTGGTCAACACCTGCAGTCTGTGGCTT
ACCAGTGAGTCCTGGGCGTGCTTCTTTCACGCAACCAGCGCATTACGAGAGTTCCAGGCGTTGCCTTCTCGACTTGTGTATAATCAAGTGGAAGCAAGTC
TCACGACAAAGGACGAGCGAGTTGATTTTGTTGAGCTGGTGTTCCAGAACAAGGAAGAAATTCGACGGAGAGAGGATATGAAGCGACAGGATGTGACATC
GAGCTCTGGGACCAGCGGCGGATTTTTCAGTGGCGTGGCGTGGCTGATGTCGGCATTCGAGACAAACCCAAGCTCTTCGTTCTCAAACTCGACTTCGCAG
CGAAATCAGCTCGTGCTTGGAGAAGACGGTCCGTCTAACCCTGCAGAGTGGGCAGAATACGCGCAGGACCTAGTCATTCAAGTACCTCGAGACGATTCAA
ACCATGAAAGCAGTGACGGTGGCGAAGTCGAGTTTGGCACTGAAGCCTGGATACGGTCGACGCTGGAGCCATACAGACTGGAGTTCCTGCTTGACGATTT
GTCCAGTCTACCGCCTCGCGCCTTGGTGGAAATCGTCCGAGCCTTAGACGAAGAATTAACTCGAGCGTTAACCGGAGCACCGAAATCTCCGTCTGAACAA
CTTACTGCTGTTCACAAATCCGGCGGAAAGCAGAGGTCTGGACATCAATTCGAAGCGGGTGACCATAAGATTCTGGCTTCGTCGGACCTGAGTTCCGCGG
GATGCGTGCTGTTGGAGCACTTTCTCGCCCGAATTATCTCGGCAAGCGATTCCATGACCTTCGACAGTGAAATGGCAGATGACGAGGAAGATATTTTCAA
GATCCTCGAAGCCCATTACACTCGCTTGCTGCAAGCGCTGCTCTCTGTCTTGACAAACACAGAATCGGATTCCCGAAGAATCTCGTATGAGAACGCGTGC
TTCCTACTGCACAAAGCAATCGATGGCGTCTTCGCGTTGGCGATCAAGATTCAAAGCGATCGAAGCAGTGCGCTGTTGACGAATTTCCTGGGATCACTAG
TCGACATCAGCGGCGACGATGAGCTTGCTCGACCATTCTTGAGCCAGATTCTCTCTGGTCTCCAGAGGCTTTTCACGTCTACCAGTCCAAGTTCTTTCCA
GTACACCCGCGAGCAGTGGCTGATGGTAACGAACCTGATCAGCTGGTCTGTGAACACGACTTTCGCAGCATCCCATGGATTCGCGGTGCTGGAATACCTT
GTGAAAGCTCAGATCTGGAACGTTGACGGGAGCGAAATCTCCATCAGTGATTGCTACACGAAAGCGCTGATGTTTGCCTTGACACGCGCCGATGACAGTG
GCGAGAGGAAAAACTGGGGCCCCAAGCGCTCCATGGAGTTGCTGCATTCCATGTGCAGTAGTCTTGGATCAGAGACTGAGGGCGATAACGAGGAGCTGGG
ATTACGATTTCTTGGCGGCTTCGTCCTCGCCATTCGGCATCTGCTCAAGAATTCCGAGTTGGTGCTCGACCAAGGCTCCATATCTCCAAATGAGCTCGTT
GTGACGAGTCTGGGCTTCGTTCAGGAGTTGCTTGGTTCCAGCAGCCAGAACAAAAGATTGTTCAGTACGGCGTCATGGTTGGAGATTCTGCAGCACGGAA
TTCTCCCTCTCGGCTTTGATATCTTGAACGAGAAATCCAGCGTAGCGTTGATGGAGGGTGATGCAACCACGTGTCCACGCATCTTGTACTACCAGCAGCA
ACTGTCCGCTCACCACATATCTCAATCGAATCCAAGACAACAACAACACGCGGAGAAAGGACGACGACGACGACGCCCTTCAGTTGTGAAAGACCCGTTT
GCACTCCGCCCTCACGTGCTCATGGTGCAGCTGATCTCTGGCGTGGTCTGCGAAGAATTGAGCCAGCTGACCCAGTTTGAGAGCTTCTCGAGTGTCTGGG
ACGAGCTTGTCGATCTTCTCATTGGGTTGCTGCATCACACGCAAATGAAGAGCAGTGGCAGCGGTGAAGCAGCTCTGGCAGCGTTGGAGCGACGGAGCGT
GTTGTCTGTGCACGAGGAGATTCTAGAGCACGTAAAAGGGATTACAAGACGGCTTACAGCACTTCAACTGGACGACGAAAGCAACTCATCTGTGGCGCAT
GAAGAGCAGAAGCAAGAGGGGGAGGTGACACCAACACCCCGAAAGTATCACGCGTTGGTCCACACGCTCGTGGAGAAATGCCAACCATATCCTGGACTGT
TTGAGCAGCTCTTTCCATCAAAAGAAGACTCGAGTTCGTCCGGAGAAACCACTCCTCCACTACTCGGAGACGAAGAAGAAAACAGATGCAGCGTCGCGAA
CGAAGTGGCGTAGACCCAAGGGACAAGCAAGGGATGTTCAAATGTCGATCGCTATGAATAAAGACATTGGTGATTCATAAAAATGGAAAGTGAAAACTAC
GGATGTACATCACACATGTTCTTGATGTCAAATGTGTCTTCTATGCCTTCTGGCCGTGGCGGTTGCTGCTCTGGTTCGAGTCGAAAATTTCCGACTCGTC
CACTTTAGAGTACGCGGTGCGGAGTTTCTCTGAAAAGCACTGGGTGAACATCTGCGTCACTTTGTCGATCACCACGTCCTTCAAGTTGACCTCGTTTTGC
TCGATTGCCATGTCGCAGAGCTTCTCAGTCGCTTCGATCACGAGCGATAGCTGGAGCATGGGGATACGTTGAGTCAGAACACAAAGTTAGTAAACCATAG
CAAGCTAGCAAGAGTCATCCACCACCCCACGTACCCTTTCGTTGACTCGCGCGATGTTCTCCTCGACCTTCTTCGCGCCTTGGGTGGGGGACGTTGGCTT
TTCGCGCGCCGATGTCGCCTCTGGTTCGCGCAGATCCTCCACCTCGATGTCATTTTGATTTCCTGAAGACGCTGGCTTCTTGCCGCTTGCGGACGCCTGT
GCGCGCTTCTCCAGCACCTGAAGCGCCTCGTTCACCCGCTCCTGGAGAAGCGCCATCTTGCGCACACTGGTCGAGCAGTTCGAGTTGGCATGTTCACTCA
AATGGCTGAGGCATTTTTGAACGCTTTCCAACTCAACCGCGAGCTTCTGCGTTTCAGCCTTCGCAGCGAGGCGCTTCTTGTTTGAATCTTCGACTTCGCG
CTTTGCGTTCGCGAGTTCCTTCGCTCGCTGCTGGTTCTTCTCGGATTCCTGGACGATCATGAGCGTTTGCTTTAAAGTCGAAATCTCATCCGAGAGATTC
TGGAGGCTTGACGAGCTCTGCGCGACTTTCTGATTGTTCTCATCGTTGAGCTGCTTCAGGCGCCGCTCATTCTCGACGTTGCGCTGGTTCAGCTCCATGC
GAAGGCGGTCGACTTCCTTTTGCAACTCGCTTCTCGCCTCGACTAGCGATTGCTTCTCGTTCGTGAGGGAGATCACGAGCGCTTTGGCTTTTTGGCGCTT
GTCGTTGTTCTCTCTATTGATCGCGTCGATTGAGCTGGTCAACTCTTGATTCTTCTTCTCGACCTGCGCGAACTTCCCTTGTAACTCACGCAGAGTTTCT
TCTGTTTTCTGCTTCTCTGCCAGAGCCGCTTCTGATTGTTGTTTGCGAGATGAGCTGTCCAATCGCGACGCGCTCACTTGGTCTTGTAGCGCCGCAACTT
CAGCACTCAGCTTCTGCACATCGGACTTGAGCGCATTCACTTCCGACTCCTTCCGGAAGATCTTCTCGTTCAGGTCCATGTTCTGCTTGGATGTCTCCTC
CAAGCGCTCTTTAGCTGCAGCGTAGTTCTGCTGCATGCTTTGCAACGAACTCAGTGCTGTCTGAGCCTCAGCGAGCTGGATGTCGCTTTGGCTTCTTCCG
ATGTTCACTTTCTCATACAGGGTCGAGATTTCGGACAATTCGATCTTCAACTCGTCGCATTTCGCACATGACTTGGCTGCTTCTTCAGCTTTCGCCTGCA
GTTGGGCTTGTAGCGCTGCGAGTTCCCCCGCGAGTTGCTTCATCTTCTCTTCGCCCTCATCGGCTCTTTCTCGGTAGCTGTCGAGCTGTTCCAATTGGAA
ATCTTTGTCGAGCAACTGCTTCTGGAGATGCTCATTCTCGATCTTGTACTGCTGGATTTGGTGCACCAGCTCTTGGTTCTTCGAAAGAGCCTCCTGTATA
TGGCTGTGCTCCTCAGCGAAGGCAGCATTGGTGTTTCCCTGAGCACTCTTTTGACTGGTCAGCGAGCTTTCGAGGACTTGCTCCTTGGTCTTGAGCGCGG
TCACCTCTGCCTGCAAATCACTAAGCTGCTCCTCACTGGAAAACTGGAGTGATTCAAGCTCGCTTTTGGCTTTCGCCGCTTCTTGAGTCCGCTGCGAGGC
CAGATCCTCCGCTGTGCGCATTCGGTCGCTCATTGCTGTAAGCTCTTGCTGCACAACTTGAAGCTGCGACTGCAACGTCGCGATCTCATCGTCTTTCTTG
GATGATAGAGCGGGGTCATCAAGGCTCAGCAGATCGTGAGACGCACTTGAAGTTGCGACACTGGCTTGCGCGAGCGCCAACGCAGCGA