Description :
From Genome Similarity Track
Location :
Scaffold_1391:257- 2766
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1391-snap-gene-0.1Vacuolar protein sorting-associated protein 35

Sequence
2509 bases(100 bases per row)
TTtCGTTTTCGAGGTCACGcGTCCCTtCTTTAGCTCGCTCGCTCGATTTGTATGGCGCTGACAGCTGCACGGGAGGCAACTTCTCGGTTCCAGATCTTGG
TGATCCCAACGGCACAGACAACGTCACCGATTTGTCCGAGTTTGACTGCAACAAGATGCTCTCGTTTGTCGTGGGTAGCAAGAAGTCAGTGATTAAAGCA
CAAGCAAGTGCTTGTCAGTCAGTCGACGTGGTTGAGTCCAAAACAGGTCAGGACCAGGTCAGGTCTCATTATTGGGTCAGGATTCCCACCTATATCAGTA
TGAAAGGAGAGTCAGTAACGGTTACGCGCTTCGCGCTAGCTTGCGCGACGCCTTCTGAAGAGTGCTCTCGCCTGTATGAGCGCCTTCAACTACGTCTCTT
TCGACTTTGGCTGTCGTCTCCAAGATACATTTGGGCCATTGTCCAaGCTGAAGCGGTCTCTTCGGTgTACTCTACTCCTGATCTGTACTCGACTTCTCAG
TTCAAAGTCGACTCCGTTCTACGATTGAAATAAAAaTTATGTTGtAaagtGggTGGAAAGAGTAGTCTATCCGTCTGCTaCGGTGCATTAGAAAAAGCTC
CGCAGACGACATCCCAGAACGCTTCAGATGCTTGGTCGGCTCCGGTCACTGCATTTTtGCTTGCGTTcACCCATGCACGATCCAGCAGACATCTCCATCG
CTAAGGCCGCTATAGCGATGCGGTCGTCCCGTTAGTAATGCCCTGaGTCCTCTTGTAATGTCGCGACGCAGTACGGAGatCCTTTCCGTGAATCACCTCA
GTTCTTTCAATGCAaTGATAcTTGGAATTGTCTAACGTATGCGTATTGATATTGGACAGAaGAATAAACTCAAGACCCCTGTGATGTGAATGCACCGCTG
CCACATACTTATCACCGTATGATCCTATTGTACCATGGGAGGCGCATTGCCATGGCACCATACGAATCCGCAGGTGTACAGGTGGAGTGAATGGATATaT
ATGTCCTTGTGCATCGGCATGAATGCAGATACTCAAAATTCAAGGGTCTTGCTTTCCATGTACCGGCGTATGTCCCTGAAACGTAGCTCGCACTCACTTC
TTGTACTGCCATGCTCCATGTTCTCGAGATGTTCCTTCACCAACGCGGAGAGCCCAGTCAAGTAATTCGCTGTGACTGCGGGGACCTcAGCTTCGTAAAA
GTATAGGTACTGAAGAAGTAGTTGGAGGTTGTGAGCGACATCAACTTTTGCAAAGTTCGCTGAGCACTTACCACCTCTAGAATGTCCAGAAaCAGAGGAA
CTTTGGTCAGCGCAGTTGTGGCGCTGGTTCCACTCGCATCCGCCAGTCGGAGAGAGCGCTGTAAGCATTCCAGTACACGcTtCCCGTCCTGAAAaGAGGG
gTGCTGGATACAACCATTAGTCAGCAACACAATCAGGAAGCCAGCTtAACACATCACGTACCCAAAACAGATGTGCGCAGTTGAGAACCATTGTTGCTTG
GTCCGTCTTCTTGAGCAGTTTGGCCGAATACTGTGTGGTCTTGGTCGCAAGTACTTCATAATTGGCATTAGACAATGACTTGGTGGCACGCACACTTGAC
ACCATCAGTTCCAACGCTTTCCACTGCTCGCGAGAGTTCGTAATCTGGTCTTCGTACACAATGAAAGCTTGAGTGATGAACTCGTACGCAATGGCTTCGA
AATGACATCCATCGGCGACAAGAGCACACTGCAAGAATAAGTTCACACACGTGACAGACATTTGTTCCAGTTTTGAAGCAAGGGCTGTCACCATTTCGTG
TACAAACTGAAGCACTTCACGCGAAGTAATGGTAAAAGTGGTGGAGGATTTGCGTTTTTCCAGCTCTCGAGCCAGCGAAAGTGATGCAAAAATAaGGGGT
ACAAGAGTGAACCGAATTCGAAACACACCACCTTGACCGAAGTGCTTCCGTGCAATCGAGTACATACGGAAGGTTGTGTCGAGGTTGCCCTTGCTGTCAA
TCAAATGAATCACTCGAGAGAGGTGTAACTGTTCTGCCTCGAAGcCgTCTTTCGATGAGGATAGCGGCTCACTTGTCATCGGTTGGTCATTTGGATCGTC
TTTAATCAACGGTGCCAACAGCTCAAGAAGTGTGTCGGTGTCCTCTGTCGACTTAGCAAGTTCATGCCGACGGAAAAGTGTaTGAATCCATTCCGTCATC
AACTGCTTGCGGgTTGTTTTCCATGGTAGCATTTTAGTCAGTTCGCTAATTGCACTAACCTCACACAACTGCTGCAGAGACAAACTCTCCAACAGCTCTT
GAGCGATTTGCTTGATGGTCTCAATCACATTGGTCGACTCGaGGgCCACCTCCCGCGCTTTCAAAAATGAAAGTGTCTCTTCACCAATGaGCTTGACAAA
AGCAACTTTGTTCGTCTCATCTTCGGTACACGTTAGCACAAACTTGTTGAATCCCAAGAAGAGTCCGAGCATCGACGCTGGGCTCGTCGTGAGTTGCTtT
TCTCGAGCT