Description :
From Genome Similarity Track
Location :
Scaffold_2961:257- 2708
Sequence
2451 bases(100 bases per row)
AGGAGACTCGACGCCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTGCCACTGTTGAGCCCC
GGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCTGTGGCGGCACCCGTCAGCCAGGGAGCTGC
CATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACT
TCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATTC
CCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCAC
ATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAGCTCCATGAAGATCAGCAGCTGTCCCAC
ATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCACGCGGCTTCTAGCGCTCACG
ATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCG
ACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGC
GACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGG
CGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCTTGAGAT
TGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAG
GTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTGTTGCCACGTCC
GGAGCCGCTGCGCACACTCCCAGACGTACGCGTATGGTGCGTAACCCGGCGTACTCAGCTACTCGCTATGGCCCGGGTGCTGCTATGGAGCCTTCCGGCT
AGCGTTCGGACGCCAACCCTGGCCTACGCAACGGAGTTGTGGGTGGCTGTCTCCGACGCCCTTTTTCGACGACTGTGAACGGCCCTTCGTTTGGAGGAAC
TCGCGTTCAAGGGGGTTTGGCGAGTCAGCAACCCCCTGCGGGTACAAGTAACGGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTT
GGAAGGTCGATGGTGTACGACGCACCATGTCTGCCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTAACAGTGT
CTAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCCGAGTACTCCTTTTGTTTATC
TGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACATGATCAGCTGTATCCATAAAGGATTCCACCTGTTCCGCAGCGAAACGGCTCACATCGAGACTGG
AGAGAAAAGGCTTCCGAGCCTCTCTCTCCTCTGAGAATTGAGAGAGATTGCCATGTTTTTCTGGGAGAGAGGGAGAGGCCTCTGGGGGGGGGGCGGAGAC
CCTTGCAATGAAAAGCGGCTGAAACCGCGGGGAGCGCTGGCACGCGGCTTTTGGAGGCCCCAATCTCAAACACGGGGAGAGCGGGTTTGCAACCACTTAC
GTGGGCACGTACGGGGTGCACCCGGAAAAACGTGGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGC
AGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGA
CCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGAC
ACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGAAGCCCAAA