Description :
From Genome Similarity Track
Location :
Scaffold_1267:257- 2058
Transcript NameFunction/comments
Phyta_totarag12568hypothetical protein

Sequence
1801 bases(100 bases per row)
ACTTCCGAAGTCGTCGGAGTTTCTTCATTCGCGCCCTGCACATCGAGACAGCAGCGTTCAGCGCTGTCTCCACTGAAAGGTTGCATGCACCTCGCGGTGC
ATTTATTGCGCTGACAGGGCCATCGCTCACTTTCACGCTGTCGTAACCGAAGCGTACAATTGCACGTGACTTCCATTCCATCTTGTGTCATGTCGTGCAA
GCCACGGCATGTCCGCACTaagtcgaacttgtcgtctaaGTCTAAGACGGTAAGATCCTCAACAAATTCCTTTTGTTGATACGAGAACTGTACGCGAACA
GCACGCTTCCCAATTTTCACGACGGCACCTGTTgccagtcgtacttccaatacgcttcgaggtgtttgctcctcctcgaagGCAAGGCTTGATAGACTTT
GCTATCGAACAAAGATGTTCGACGCACTTGAGTCTACCAAGGCATGAAGTGAGCCCGCTTTCTTCGAAGgcacgtccaggatgacaaGGTTTGGCTTGTC
ATCTCGCCTGTTGCAGTGAGCTTACCTTTCACTAGGGGCTGCAGTCCTCATTGACGCGTGTCCAATGTCGACACACGTGTCTTCTTTACCAGTAGGGAGC
CCCGCGCCTACTGGTTCCACATCTTTTTTTTAATTGATCGCGGCGATGCCCGGCATCGCCATGTTAGCCTCTCTGCCCTTGCATGGGTGCTGCGCACTTG
CGTGCAAAATGGACGGTGCATCAGCTACGGAAGCATCGTACGTCAGTCCCACGAGTAGTAGGTTATTCCCTGCCGTCGCGTTCGAGATGTTCATTGGTTC
CAGACCTCCCGTCCTTACAACCGGACGTGGCCAGACGTGGCACGTTCACATGCAGTTTAGCCTGCAGCAGGCTAAACCTTTCCTGCATTGCGAACGTGAT
CTCAGCCTCGAGAGTACTCGGGTACGCTTTGAAGAGATAGGCCTTGACCGGCCCATCTTTTAGGCACTTCATGAACATGACGACCTTGGTCGCCTCGTCA
ATCGGGTTGGTCGCGATGTTTGAGACCACGTATCGTGCCTTTGGGCGTAAGCATGGGCATCACGGTTGCCCTGTTGCAGATCGAGGAACTCTGCCCTCGA
TCGGAACTCACTTTGCGGGGGCACAAAATGATCGTctgagctcctccttgaaTGCCTCTTACGTGCTAAGGCACGTAGGATCCGCGAGTCGGCGTCTGTA
TGCCCAACGCCTTGCTCGTCCGCCAAGGCACGACGTGGCGAACGCAATTTCGACAACGGTTCGACGATACGTTGAGCCGTAATAGCTGTGTCGACTTCGG
CAAGCCAACTGAGAAGAGGTTCACCCTCTTTTCCCACGTAGTTGCTCACGTGGAGCATCAGTGAAATTGATCGCGGTGTCGCTGGGGTTGACGCCATCGT
AGAGGCGGCAGCATATCGCTGGCCCTTAATGGTAAAGCCCAGAGCAACACCGTGTTGCTCTGTCGGTGATAGCGTGCGCAACATTGCTGCTACAGCCGCC
TCGCCAATGACTGTTGACAGTCGTTGGAGCGCCTCTCGCTCTGGGTCCGACGGGTGGGGGCAGTCTGCACGCGCAATGTGTGTTGCAGGCGTAGTTGTGC
TTCCGTACATCGGAAGGTTCACTTGGCCACGTTCGTAAGAATTGATATGAACGTGCAGTTAGTCGGTTCTTGGACGGACTACAAAGTACTACCaggtgta
atgggcctacttacCCCAAaacttaagcttacacgtgtgcgcacgaGTATGAAGAAGCGTAGGTTTACTTAGgtttattatacttgcgtcctgcaagtat
a