Description :
From Genome Similarity Track
Location :
Scaffold_32:25692- 27088
Sequence
1396 bases(100 bases per row)
CGTGCCAGGCGCGATATTAAGGTGAATACACTACCGCTCCATACCTTCTAGTTTAAGCGAGATGGAACCATGTTAGATGGTATGCTTATGCGAAAAGTTT
CACACATAACTTTATCCAATCAAGATTGGCTGTTTCGAGTGTTTACTTAACAAAGGAAGAATGGAGTGAATTTGATCAAAAAAGGTGAATCTAACAATTC
TCTATAAATAAGAGCAAAATAAATACTCGCTATATTAAATAGTGCGCTATATTGTATTTATGCTCGATAACATTTAAGCACCGAGAGGAAAGGTGACAGT
ATTGTGGCATACGTGATATCAGCCAATGTTTTATATTGAGACAACTTTAAGTGAGAGACGCGCTTGGACTGCTTTTCATCATCCTATACTGGCCAGCGAG
CTACTGACTACAAACTATATATGGGTTTGAAATAGGGTGTCTATGAGTGCCACTCAAACATCTGGATTCCTCTTTATTCATCAACTCGTGGCTATTACGA
GAAATATATATGCTCTCATTTCCTGTTGAGATTTATTCTGTACCTTGGTTCGGATGCGAGAAAAGATATGAATACAATTCAACTAGTCGTCCGAATTTTC
CTTCCGGTCAGCACAACAAATAGTGATTTATCCCGAAAAATGAATGCAACCCAAATCATGACAGATTAAACAACATCTCGACGTTGCTCCGACTGGTGTA
CAGGCAGAAGTAGTTTACTTCAGTATAGGTGACTTCAGGTCCTCAAGTTTCCAATTTTTTTTAGTCCGAGAAAATTCTCAGATATTCCTGGTTCCACGCG
CAGCAGCCAGTCTGTAATCGAGGAATTGGCAGCAGCCTTGTCTGCGGCCTTGGAAAGTAAACTATTCTCCACCTTGGCATCAAAAATCTAGCCAAACTCG
GCCATCACACGACTCATTGCAACGTCGTCACAATACATCAATTCAAAGATGATAATGCCATTAGTCAGGTAATGAGTGTGACCCTTTAAACGTGATATCG
GTTATATCTTACCTTATAAAATTATGTTCTAGAACTAATACACCATTACTAATCACTGATACTGTGATGATTGACTGGCGTTTCTTCCATCAAAGTGTTC
TAACTAAAAAGAATATTATAGTAGTGTTTTATTAACTTTAGTGTAGGGAACTTAGGAAAAAAATTATGGTCGGAGATAAATATTATATAAGGTTTCCGTT
CACCTTGAGCAGAAGATTTGAATTCCTTACAAACTTGTTACTGTGAGCACTTGTGCTGTTATTTACCTGTGAACTGTTAGTTTTTTTCGTGTTGACTGTA
GGGTCTTATCAAGCTCCTTATAATGAAGATACTCGAAAGTCGTTGTTCTAAGTTCTTTAGAACTAAGTGGCTGTAAGCCAAAATTCTTTTTCGACC