Description :
From Genome Similarity Track
Location :
scaffold_20:256907- 258654
Transcript NameFunction/comments
Plaha_PHALS_01925RxLR-like protein

Sequence
1747 bases(100 bases per row)
ATATTGCAACGTGGCAACAATCAAAGTCGATAAATATCGTTTCTTCTTGATTGAAAGCACTGCTGAAGCTGTGCGACCGCACTTGAGCGCTTTCCTGCGT
AAATACTCTATTTTGGCTACTTGTGACTTTGCGACTTCAGACAAAAAATACCTAACGCAATACTTTTGACACAGCATCTTGCTGTCTTTGCGTTAGGAGG
TATAAGAGCACAGAAATCTGTGTACGGTGTTCGTGGCTGTAATTATAAGGTCAGAAAATTATGGTAGCTTCGGCTCTGCCGGGAATACATGGGAATGATC
CTGCCATAGTGCTACAAAACCGGTGGTAGCACCATCTTGCGAGATCTGTGTTAAGTAGCTGAAAAAATTGTCGCGCATACTAGGGGAATTCGATCAAACA
CATTCTGGACATATAGAAGCAACTCTATATCAGAGTCAAATTGTGCAAACATGCCGTGTGGCATCAGCGAAGGAACAGAAACAAGCTTGCTCTCCAGATG
CAGCGCATAGAGCAACTCTATCAGCGCCACACATGGCTCACCGTCGAGAAGCACTTCTGCATCACTAGTATAGCTGTCGTCAAGACCTTGCCCATTGGAA
ATAACTACGCTGACTGCAGTTAGAAGCCGCGGTTCAAACGTATGACCACTGAATCGTCGAATGTATCAGATCAGTGCGTTCCAATGGATACGATCCATTG
CTATCAACAAAAGAGCTCAATAAAATCATCCGCCGGAGTATAATACTCCGGCGGCACTGCTTACCAAGTAAGTATCTTGCTCGTCTATTTCGAACAGATG
GACTCTGCAAATTATTCTGGTGTTTAAGCGTTATCAAGGGAGGTGGAAAGACATTTCCCTCGATAATGCATTCCCGCAACAGGTGAACAAGCTAATGAAA
ATGTCAACGGTGTCACTCGCTCATCTGCTATTGGTCAAAAATTGAAATCATAACTATGGTGGTTTGCGGCTTGACGCACGTAGAAAATTCCGTATGACGT
AATTGGGCAAGAATTGGGTGAATCAGGGCTATCCAGCACAATGCGCCCTGCCATTGAGAAAGACTTAGCCTTGCCATATGAGAATTGGCAGAAAATGCTT
GCACCAGTTTCAAAACGATAAGTAGCGTGGCATGTAGCGATAACGAAATATCAAAAGAAATTACTTCGATATCTACATGGCTGTGTACCTCGCAAAGGCG
ATCATAAAATTGATAACTTAGTTTGACGTATGCACTACTAAAGCTGACATTTGAATTGAAACATAGGCTCGAATGGACGTGTATCCTTTATCCAAATCTA
AAATGATTACAAATACTCTCTTAGAATTTCAGCTAAGAGAACCAGTGGATTTGATCTCGGGGAGTGACCCATACCCCGAATTTTTAGGCGCAGAATCCGA
AGTGATGATGATTTGTAGGAAAATTATGTACTGCAGAAATTGCATTTGAAGGCAAACTACTTGCATGTAATGAAACGTTTTACTCAACAGCATAATCGTG
TGTGTCTTGCTGTCTCTGACAGTAAAATACTGCTCTATCTGTGTTGGCTCTCAGTCATAGTATCCCACACACTGTGCATGACATTCAGTTATACTGAGCT
TTGATCATTAATTTCTGCTCACAAGGTTAGCtgagctgatatcagcaagtcgaatATGATTGCCTGGCTCTCGCTGACTAAAAGGAGTCAATCTGTGGAG
ATATGAATCGCACCCAAAGCCTCACCAAACTAGTTATATAAAATAGT