Description :
From Genome Similarity Track
Location :
Scaffold_1133:2569- 5240
Sequence
2671 bases(100 bases per row)
GCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGT
CGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTATAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTC
TCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTAGAAAACGCTGTTATCTTTACTGGGAACTCGTCTGCAGATGTCCACTGC
GGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACG
CAGCTCCCAGTTGTTGAGTTTGTGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACACCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTC
TTACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCG
GAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGAC
AAACAAGGAAGAGGAAACTTAAGTATATTCGAGGCTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCCTGTAGACACTGTTAGCTCTGTCGGCAGC
AACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGTCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGA
CGTTCTATGTCGACGTCTAGCGTACTTGACCGCAGAGTGCTGACTCGCAGACCCCCTTGACCCAGCTCTCGAAGCGAGACCGTCACAGTCGTCGACGAGG
GCGTCGAGCAGGCACCCAAGCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCG
AGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCAT
GCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGA
CGAGCGAACTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGT
CAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGC
CCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGG
TTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCAT
AAGTAGTCCGGGGCTTCTTGCCCGACCGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTC
CCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCAT
AACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGGCAGCTCTCGTTACCCAGGGGTATCCCCA
AACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCC
TCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAA
CCTCCAAGAAGAGGTCAGCCCCAGAGGTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCTGCCACCGAACCCCC
ACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATAGCACCCTCCTCTTCCTCTTCTTCC
TCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTTTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCT
TTAAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGC
TTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGT