Description :
From Genome Similarity Track
Location :
Scaffold_1339:2569- 3607
Transcript NameFunction/comments
Phyta_totarag12752sterol 3-beta-glucosyltransferase, putative

Sequence
1038 bases(100 bases per row)
GTCGCAATCCGATCGCAACATACTGCTGGATGCTTTCTTCCCAGCTACCTGTTGTCATCATGCAAATGTTCATCTTCGGCAGCGGCTTGCTGTTCAGGCT
CTCCaggcgcttcttctgcgtttcttcctctttgTGAGCCTCAGCTTCCAATTCTTGAACTTCAGCCTCGTGAAGTGCCTCGCCAACCTTCCCGCCATCA
CCAAAAGTAATCTCAAACGAGTCACTACCGTTGAAAGTGGCCCCACCCACATTTACAACGATAGTTGCAGCATCCTCCGTGCTCTCAGTGGGTGCTGAGG
TCGATAGGCTACGTTTTGTCAGCTTGAACGATTTCTGCCCGTGCAGTTTGCGTTCCTTCACAAGCGCGTTGAATCTTTCTTCTAACTTGCTTTTCTCCTC
AGGTGTAAGCCGAATAGCGATTTGTGAAGATAGCAGATTATTCGCATCAACCACTTCATCTGCACTCATCGACCCGTTGTGGACATTGTTGCGAGTCTTG
AAACCCATAGCgttcagcaacttcttgttATCCGCAATGAGTGAacccttcttcttgtcgtcatCTCCGCGGACGTTATTGTAAGCTCCTGTTGCAAGGT
GATCAGCAAACACTACAGTCCCCACCAACGGACTAATCATCAACCCACCCAGGCCCTTTACTAGCCCGATCACAGCGCCTTTTGCCCCCTCTTCGCGGTA
ACCTTGCGCGGGCTTGACAATCACATCCTTAAAACCCGATCCGAACACGTGAGCGAACGCGCCCACACCAGCAGATGCGCCCTCGAGAACGTTTTCTGGG
CCACGCGGCGAGTAGTCCACGAAATTGTACTCCACGATATCCGCCGGCGAGTTTTCAGGACGAGAGATCACTACAAATTCGCACTCGTCACACAAACGAA
TTTTGTCCTTCTGGCTCCACAttgttgcagctcgtccgcAGTCTAAGTTGCAACGCATGTGGTGCAGAGGCAGATTGCGATAGAAGCACGTTACAGCTTC
ACCTGCGCCGTCCTCTTGACGCATGAGATCGCGCAGTG